Nov 18, 2025
May I ask why you have GCTAGCTAGCTAGCTAGCTACTGA in your banner? Who's DNA is that.
It's a filter under the object category in Glitch Lab, which I used for my layout :)
Note: Mode was where I got the specific one for my banner
seen from United States
seen from United States
seen from South Africa
seen from China
seen from United States
seen from Malaysia
seen from Russia
seen from United States
seen from Thailand
seen from United Kingdom
seen from United States
seen from Thailand
seen from United Kingdom
seen from China
seen from United States
seen from Italy
seen from Türkiye
seen from Croatia
seen from United Kingdom
seen from Australia
May I ask why you have GCTAGCTAGCTAGCTAGCTACTGA in your banner? Who's DNA is that.
It's a filter under the object category in Glitch Lab, which I used for my layout :)
Note: Mode was where I got the specific one for my banner
I have almost 2k saved and I will spend all that on commissioned stuff of my f/os, reece, xianyun, Mikey, the guide, and Dr man fly and no one ain't gonna stop me
Next fanart may be blush blush or not idk I have 5 wips
I say I'll post more of my blush blush fanart here and other platforms then a day later I want to take a break posting fanart nearly everyday because I've been treating my mental and physical health bad like I've been staying up for 4 days straight and I didn't eat anything
haha man I do love making decisions