ㅤㅤㅤ

bitch this is a 1 in a 365 chance I post here

[reecesplotdevice]

ㅤㅤㅤㅤㅤㅤㅤㅤ˚₊‧꒰ა 𓂋 ໒꒱ ‧₊˚

Click the green text → directly sent to my strawpage.

[reecesplotdevice]

[yourfristartend]

Rating some Whippa ships i found in the fandom:-

(Note: self and oc ships not included)

1- Qhippa (Quinn x Whippa)

Art by @watercat72 on tumblr

6-7/10

I kinda see it but not my cup of tea. I think police and law people would dislike the duo because of how they got away from what they did.

2- Whiplee (Whippa x Koilee)

Art by @koriloveswhippa on tumblr

11/10

MY FAVORITE ONE. I think their chemistry is cute and I wanna get rid of my writers’ block to do something for them.

3- Whipjoy (Whippa x Joy) (both alter egos included)

Both Arts by @muddaisy on tumblr

7.5/10

The ship kinda ate ngl. But I prefer the canon joymoe (sorry).

4- Whippa x Janana (not sure if it’s a ship but I’ll include it anyways)

Art by @cluelessthecoolest on tumblr

5.5/10

I don’t see it.

5- Whippa x (Mitch, Hacky Zak, and Gremmie)

Post by @alaskacoolkid1 on tumblr

3.5/10 with Zak and Gremmie

4/10 with Mitch

I don’t believe in straight Whippa. But some bonus point for Mitch because I think the ship dynamic would be funny.

6- (Whippa x Prudence)

Edit by @reecesplotdevice on tumblr

6.5/10

The ship might be cute opposite attracts but I like cooper x prudence more.

7- Doan x Whippa

Photo by @chloe_butterberrys on instagram

2/10

No

Doan is a real person and again I don’t see Whippa with a man.

8- Whippa x Gabitha

8.5/10

Interesting a bit too much.

It’s just my opinion.

If there are any more Whippa ships, tell me about it/them.

And Mousse x Whippa sibcest shippers, GET THE FUCK OFF.

[reecesplotdevice]

I just saw this now hello?? Uhmm thanks for the credit because there are people in this community who wouldn't be decent enough to do so.

but I immediately saw the mention of coopdence and I would like to mention that I have that ship on my dni and I'm more of a mousse x cooper, so if you're gonna interact with my work, sorry. Atleast your honest with the rating I guess. No offense given or taken.

[refiieatpotat0es]

For my Sonadow lovers💗💗

[misumizuwu]

:p

[reecesplotdevice]

Stop liking the fucking original now. Fucking bitch.

[reecesplotdevice]

May I ask why you have GCTAGCTAGCTAGCTAGCTACTGA in your banner? Who's DNA is that.

It's a filter under the object category in Glitch Lab, which I used for my layout :)

Note: Mode was where I got the specific one for my banner

[reecesplotdevice]

[valenrepetto]

Remember that chart I made last year? Here's the uploaded version lol

Lemme know when we get the 3d renders of the cowboys

[reecesplotdevice]

#sonadow

[reecesplotdevice]

It's my 2 year anniversary on Tumblr 🥳

2 YEAR ANNIV 6 DAYS AGO I JEEP FORVETTING MY TUMBLR HI

[wastedskins]

Silent Hill 2, 2001

[reecesplotdevice]

Freakazoid2000

[reecesplotdevice]

I accidentally drew 6 fingers on his left hand and I didn't notice after I literally posted it to two of my sps focused socials. This one is edited to remove the accidental extra finger so do NOT CANCEL ME FOR AI!!!!!!!!!!!!! 1!!!!!! 1! 11! 1! /JOKE

[claudemach]

me when im the fast and furious swan boat (flamingo)

art trade with @reecesplotdevice

[reecesplotdevice]

Dude...... Hell yeah.............

[reecesplotdevice]

What do you mean I forgot to post this before posting the cookie kitsunes.

Anyways, old wip from March I decided to finish

[reecesplotdevice]

I kept avoiding having to draw these dudes as cookies but now. Its done.

On the topic of cookie bb boys, I might redraw the first one I did, since they didnt really look like the crk style at all. They're pretty ugly yet theyre my top post on this account and on my twitter where volks va commented on it (and xianyuns va liking it)

Anyways, I made a gdrive w all of the sprites of them transparent here

New bb cookie art when new guys drop or a pf boy becomes dateable. Who knows ❓

[reecesplotdevice]

The sight of you dead, I'm so glad it's over now

BRIGHT COLOR CW BELOW

Lyrics: