Monterey Bay Aquarium

@theartofmadeline

Kaledo Art
"I'm Dorothy Gale from Kansas"

Andulka
Jules of Nature

Product Placement
trying on a metaphor

No title available
No title available
TVSTRANGERTHINGS

#extradirty
Cosimo Galluzzi

JBB: An Artblog!

Kiana Khansmith
he wasn't even looking at me and he found me
No title available
wallacepolsom
sheepfilms
Misplaced Lens Cap
seen from United States
seen from Canada

seen from Saudi Arabia
seen from Brazil
seen from United States

seen from Singapore

seen from United States

seen from Taiwan
seen from United States
seen from China
seen from United States

seen from United States
seen from United States
seen from South Korea

seen from Malaysia

seen from T1

seen from Malaysia

seen from Canada
seen from United States
seen from United States
@goodkingmog
every Breath of the Wild cutscene summarized:
someone: expressing deep and heartfelt emotion
Link:
Ferdinand Hodler - Dents-du-Midi - 1912
cupcakKe photographed by Luke Gilford for V Magazine, 2018
Toads. Exploring nature with your child. 1952.
Spring in the Valley, Willard Metcalf
https://www.wikiart.org/en/willard-metcalf/spring-in-the-valley
Death before sticky hands
have y’all seen that nasa pic of the earth with the sun behind it on the night time side it really really fucked me up my own soul became solid and like………….. weeped!
who wouldn’t see this and then look deeply into their own emotional playing field to see what improvements could be made purely inspired by the vulnerable earth. this is the face of all literal gods
That’s actually called the Overview Effect- something experienced by some astronauts that makes them see that “from space, national boundaries vanish, the conflicts that divide people become less important, and the need to create a planetary society with the united will to protect this “pale blue dot” becomes both obvious and imperative”.
Incase anything happens to my account here’s my entire genome:
GATTTACTCGTACGGTACGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGYTTCCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATTAOCGGTACGATCCCGTAGGGTAGGGGGTTAATTGGCTCTGAGGGTTCTYCTCAATCCTCAATCAATCCTCHUATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGAATTCCAATCAATCCTCAATCATCAATCAACTCKAATCAATCCTCHATCTNACCCCCTTTAFCOGATCCCGTAGGGTAGGATCCTCATCTACCCTTCCTTTAFCGATCCCGTAGWGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTGATTTACTCGTACGGTACGATCCCGTAGGGTAGGGGGTTAAGGCTCTGIAGGGTTCCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGHCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATTACGGTACGATCCCGTAGGGTAGGGGGTTAATTGGCTCTGAGGGTTCTYCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCACGTAGGGTAGGGGGTTAAGGCTCTGAGGGAATTCCAATCAATCCTCAATCATCAATCAACTDCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCATCTACCCTTCCTTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTCATCTACCCCCTTTAFCGATOCCCGTAGGGTAGHGCCTCAATCATCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCHATCTACCCCCTTTAFCGATCCCGDTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCATCTACCCCCTTTAFOCGATCCCGTAGGGTAGHGCCTCAATCATCAATCCTCAATCCTTTAFCGATCCCGTAGGGTIAGGATCCTCATCTACCTCTTCCTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAOATCCTCTCAATCCTCAATCAATCCTCATCTACCCCCTTTAFCGATCCCGTAGGGTAGHGCCTCAATCATCAATCCETCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCATCTACCCCCTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTMTCCAATCAATCCTCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGG…
“Moon’s shadow on the earth, as seen from the moon.” A study of the sky. 1896.
John Singer Sargent — Mrs. Abbott Lawrence Rotch. detail. 1903
living in a class society… im over it
ryan gosling playing YOU? ridiculish………….
not to be epic but i am going to kill you with a rock
cain said this to abel
god said this to the dinosaurs
it is time to stop mourning the death of tumblr for i have made
tumblr 2
https://tumblr2.webs.com/
its tumblr…2!