layla

watch my heart burn with the fire that you started in me

[jingles]

x

[dumblesbianjockenergy]

every Breath of the Wild cutscene summarized:

someone: expressing deep and heartfelt emotion

Link:

[master-painters]

Ferdinand Hodler - Dents-du-Midi - 1912

[bagelriri]

cupcakKe photographed by Luke Gilford for V Magazine, 2018

[joshmuratori]

[neo-soulless]

[clearslime]

[nemfrog]

Toads. Exploring nature with your child. 1952. 

[willard-metcalf]

Spring in the Valley, Willard Metcalf

https://www.wikiart.org/en/willard-metcalf/spring-in-the-valley

[thejakelikesonions]

Death before sticky hands

[hiest-moved-deactivated20190716]

have y’all seen that nasa pic of the earth with the sun behind it on the night time side it really really fucked me up my own soul became solid and like………….. weeped!

[hiest-moved-deactivated20190716]

who wouldn’t see this and then look deeply into their own emotional playing field to see what improvements could be made purely inspired by the vulnerable earth. this is the face of all literal gods

[greycloudsandlinings]

That’s actually called the Overview Effect- something experienced by some astronauts that makes them see that “from space, national boundaries vanish, the conflicts that divide people become less important, and the need to create a planetary society with the united will to protect this “pale blue dot” becomes both obvious and imperative”.

[mwg-drwg]

Incase anything happens to my account here’s my entire genome:

GATTTACTCGTACGGTACGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGYTTCCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATTAOCGGTACGATCCCGTAGGGTAGGGGGTTAATTGGCTCTGAGGGTTCTYCTCAATCCTCAATCAATCCTCHUATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGAATTCCAATCAATCCTCAATCATCAATCAACTCKAATCAATCCTCHATCTNACCCCCTTTAFCOGATCCCGTAGGGTAGGATCCTCATCTACCCTTCCTTTAFCGATCCCGTAGWGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTGATTTACTCGTACGGTACGATCCCGTAGGGTAGGGGGTTAAGGCTCTGIAGGGTTCCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGHCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATTACGGTACGATCCCGTAGGGTAGGGGGTTAATTGGCTCTGAGGGTTCTYCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCACGTAGGGTAGGGGGTTAAGGCTCTGAGGGAATTCCAATCAATCCTCAATCATCAATCAACTDCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCATCTACCCTTCCTTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTCATCTACCCCCTTTAFCGATOCCCGTAGGGTAGHGCCTCAATCATCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCHATCTACCCCCTTTAFCGATCCCGDTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCATCTACCCCCTTTAFOCGATCCCGTAGGGTAGHGCCTCAATCATCAATCCTCAATCCTTTAFCGATCCCGTAGGGTIAGGATCCTCATCTACCTCTTCCTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAOATCCTCTCAATCCTCAATCAATCCTCATCTACCCCCTTTAFCGATCCCGTAGGGTAGHGCCTCAATCATCAATCCETCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCATCTACCCCCTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTMTCCAATCAATCCTCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGG…

[nemfrog]

“Moon’s shadow on the earth, as seen from the moon.” A study of the sky. 1896. 

[papillon-de-mai]

John Singer Sargent — Mrs. Abbott Lawrence Rotch. detail. 1903

[bintilleil-deactivated20200510]

living in a class society… im over it

[vicevirtue]

ryan gosling playing YOU? ridiculish………….

[1-beadyeyes-deactivated20251104]

not to be epic but i am  going to kill you with a  rock

[n1n10do3snt]

cain said this to abel

[sangled]

god said this to the dinosaurs

[a-yoda-a-day]

it is time to stop mourning the death of tumblr for i have made

tumblr 2

[a-yoda-a-day]

https://tumblr2.webs.com/

[a-yoda-a-day]

its tumblr…2!

[bombussyaffinis]