Everything And Anything

[socialjusticewargames-deactivat]

[mysieee]

*insert Spiderman pointing at Spiderman meme*

[mcu-but-its-vines]

Loki: *Pulls a knife*

Thor: oh no

Loki: *Opens a cardboard box with the knife*

Thor: phew

Loki: *Pulls a gun out of the box*

Thor: oh no

[babyanimalgifs]

[mcucaps]

[dekoi2501post]

[spectregoesboo]

[taronzegerton-archive-deactivat]

random gifs of tony stark: 15/??

[birdship]

so that post about how you can get around the bot by tagging things “#sfw”? uhhhhh it’s TRUE.

i did a little test in my drafts:

i am losing my goddamn mind like how is it possible to be this stupid

[tin-pan-ali-deactivated20191216]

in a fascinating and asinine twist, we must now tag NSFW as SFW

[mwg-drwg]

Incase anything happens to my account here’s my entire genome:

GATTTACTCGTACGGTACGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGYTTCCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATTAOCGGTACGATCCCGTAGGGTAGGGGGTTAATTGGCTCTGAGGGTTCTYCTCAATCCTCAATCAATCCTCHUATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGAATTCCAATCAATCCTCAATCATCAATCAACTCKAATCAATCCTCHATCTNACCCCCTTTAFCOGATCCCGTAGGGTAGGATCCTCATCTACCCTTCCTTTAFCGATCCCGTAGWGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTGATTTACTCGTACGGTACGATCCCGTAGGGTAGGGGGTTAAGGCTCTGIAGGGTTCCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGHCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATTACGGTACGATCCCGTAGGGTAGGGGGTTAATTGGCTCTGAGGGTTCTYCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCACGTAGGGTAGGGGGTTAAGGCTCTGAGGGAATTCCAATCAATCCTCAATCATCAATCAACTDCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCATCTACCCTTCCTTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTCATCTACCCCCTTTAFCGATOCCCGTAGGGTAGHGCCTCAATCATCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCHATCTACCCCCTTTAFCGATCCCGDTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCATCTACCCCCTTTAFOCGATCCCGTAGGGTAGHGCCTCAATCATCAATCCTCAATCCTTTAFCGATCCCGTAGGGTIAGGATCCTCATCTACCTCTTCCTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAOATCCTCTCAATCCTCAATCAATCCTCATCTACCCCCTTTAFCGATCCCGTAGGGTAGHGCCTCAATCATCAATCCETCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCATCTACCCCCTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTMTCCAATCAATCCTCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGG…

[monkeysky]

You got like six unique nucleotides so nice

[deepspacepirate]

OP is a virus from outer space

[deepspacepirate]

FUCK YOU OP

[robertdeniro]

[un-magnificentlivesofadults]

My mom just sent me this picture of my dog…I guess we got a lot of snow, then

[un-magnificentlivesofadults]

update:

[back-that-sass-up]

Great update

[jeonjeha]

Avengers: Endgame + The 5 stages of grief.

[aslightstep]

‘Who is going to save Tony?’

Well, historically: Tony.

[officialwhitegirls]

me as a firefighter: *blasts burnin’ up by the jonas brothers on the aux cord instead of turning on the siren*

[hobrien]

Once Upon a Deadpool (2018)

[whatthefuuuuuuccckkkk]

the way americans are obsessed with the fuckin military is terrifying. I work as a cashier so I occasionally have to ask for donations for whatever the cause of the moment is. people will donate all the fuckin time to the troops but not only will they ignore homeless children, but they joke about it. they’re over here like “haha I have my own hungry children to feed” or “they should be donating to me I’m hungry” or other just straight up stupid unnecessary shit and it’s cruel, joking about homeless fuckin children. yet the mere mention of troops and they’re throwing all their money at me. these people are glorified murderers and americans eat that shit up and worship the ground they walk on. the brainwashing is un-fuckin-real

[strangelyiron-deactivated202012]

one taught me love

one taught me patience

one taught me pain

and one is gonna fucking put me in cardiac arrest