:) @professorauburn - Tumblr Blog

In the predator and scavenger abundant waters of Indonesia, Banggai cardinalfish – masters of parenthood – work to keep their offspring alive.

Rather than laying her eggs amongst plants or crevices, a female Banggai’s chosen partner is quick to snatch them up in his mouth. During 30 days of comfy mouth residence, the eggs rapidly develop into miniaturised forms of their parents. The male gets no food during this trial, but is supported through the starvation by the fierce defence of his partner, and the knowledge that soon his tiny offspring will be ready to face the world themselves (from the comfort of a nearby anemone).

The Banggai cardinalfish is classified as Endangered by the IUCN, due to overcollection from the wild to meet the demands of the pet trade.

Photo Credit: New England Aquarium https://www.neaq.org/

shinystuffinmypockets

Artist:

@studio_thomas_walsh / @tom_wlsh

curioscurio

Really messy team rocket bit

pafucore-deactivated20240909

Aww I saw this on Facebook and thought it was way too good not to repost

bevvy-yt

The coastal seas of the eastern Atlantic and Mediterranean are alive with the sounds of a fish far better known for its ability to walk, fly and grunt, than swim.

This unusual benthic creature, the tub gurnard (Chelidonicthys lucerna), is well adapted to life on the sea floor. While on the hunt, it appears to take a stroll over the surface using three elongated spines. These appendages are modified from the front of the pectoral fins and are used to probe the sand for hiding prey-animals. When more in a hurry, the fish spreads its fins out into magnificent gliding “wings” with which it has earned the title of “sea robin”.

Aside from these adaptations, the tub gurnard has a flair for acoustics. It’s swimbladder - the organ that controls buoyancy - contains a set of muscles that beat against the structure’s walls when contracted, producing sounds such as knocks, growls and grunts.

From research we know that gurnard’s use their grunts to chat about whichever pressing topic is at hand ranging from “oi, that is my food, please leave >:c” to “ay bby u come here often ;)”

Photo Credit: Robert Patzner Jeff Dubosc

thot-character-of-the-day

TODAYS THOT CHARACTER WAR CRIMINAL OF THE DAY IS: Margaret Thotcher from the comedy that is the continued existance of england.

dekoi2501post

picsthatmakeyougohmm

hmmm

mwg-drwg

Incase anything happens to my account here’s my entire genome:

GATTTACTCGTACGGTACGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGYTTCCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATTAOCGGTACGATCCCGTAGGGTAGGGGGTTAATTGGCTCTGAGGGTTCTYCTCAATCCTCAATCAATCCTCHUATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGAATTCCAATCAATCCTCAATCATCAATCAACTCKAATCAATCCTCHATCTNACCCCCTTTAFCOGATCCCGTAGGGTAGGATCCTCATCTACCCTTCCTTTAFCGATCCCGTAGWGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTGATTTACTCGTACGGTACGATCCCGTAGGGTAGGGGGTTAAGGCTCTGIAGGGTTCCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGHCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATTACGGTACGATCCCGTAGGGTAGGGGGTTAATTGGCTCTGAGGGTTCTYCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCACGTAGGGTAGGGGGTTAAGGCTCTGAGGGAATTCCAATCAATCCTCAATCATCAATCAACTDCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCATCTACCCTTCCTTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTCATCTACCCCCTTTAFCGATOCCCGTAGGGTAGHGCCTCAATCATCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCHATCTACCCCCTTTAFCGATCCCGDTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCATCTACCCCCTTTAFOCGATCCCGTAGGGTAGHGCCTCAATCATCAATCCTCAATCCTTTAFCGATCCCGTAGGGTIAGGATCCTCATCTACCTCTTCCTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAOATCCTCTCAATCCTCAATCAATCCTCATCTACCCCCTTTAFCGATCCCGTAGGGTAGHGCCTCAATCATCAATCCETCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCATCTACCCCCTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTMTCCAATCAATCCTCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGG…