Dont Mind Me

Hi! My name is Mad She/her, cis and bi Feminist This is a safe space and I want to except everyone for who they are.

[getoutnowdarling-blog]

Stock photos are weird

Sure you can have this photo.. but for a PRICE

And if you don’t want to pay then.. ha hA HAHAH

you can still have it but with SLIGHTLY worse quality!!!

Got em

[mwg-drwg]

Incase anything happens to my account here’s my entire genome:

GATTTACTCGTACGGTACGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGYTTCCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATTAOCGGTACGATCCCGTAGGGTAGGGGGTTAATTGGCTCTGAGGGTTCTYCTCAATCCTCAATCAATCCTCHUATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGAATTCCAATCAATCCTCAATCATCAATCAACTCKAATCAATCCTCHATCTNACCCCCTTTAFCOGATCCCGTAGGGTAGGATCCTCATCTACCCTTCCTTTAFCGATCCCGTAGWGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTGATTTACTCGTACGGTACGATCCCGTAGGGTAGGGGGTTAAGGCTCTGIAGGGTTCCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGHCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATTACGGTACGATCCCGTAGGGTAGGGGGTTAATTGGCTCTGAGGGTTCTYCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCACGTAGGGTAGGGGGTTAAGGCTCTGAGGGAATTCCAATCAATCCTCAATCATCAATCAACTDCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCATCTACCCTTCCTTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTCATCTACCCCCTTTAFCGATOCCCGTAGGGTAGHGCCTCAATCATCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCHATCTACCCCCTTTAFCGATCCCGDTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCATCTACCCCCTTTAFOCGATCCCGTAGGGTAGHGCCTCAATCATCAATCCTCAATCCTTTAFCGATCCCGTAGGGTIAGGATCCTCATCTACCTCTTCCTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAOATCCTCTCAATCCTCAATCAATCCTCATCTACCCCCTTTAFCGATCCCGTAGGGTAGHGCCTCAATCATCAATCCETCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCATCTACCCCCTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTMTCCAATCAATCCTCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGG…

[getoutnowdarling-blog]

BS... it at least 7 letters longer

[bisexualityislegit]

you've heard of bisexuals now get ready for,

respecting their sexuality

[superfluous-existence]

Can’t reblog fast enough

[rosiemutual-deactivated20180308]

smash that mf reblog if u hate pedophiles

[yoichooseno]

You know that post with the broken likes? If this doesn’t get enough reblogs to crash the icon then I’m fucking rioting

[izuku-midoriya-no1fanboy]

Reblog!

[getoutnowdarling-blog]

TMI warning

Idk who else to tell this to but.. my shit was so long,, like 10 inches maybe a ft. Carry on

[sailorbrazil]

i made an “evil sim” or at least the closest i could do to it, shez materialistic, self-absorbed, gregarious and self-assured. all she does is train her skills and fuck

[sailorbrazil]

her house looks like shit and shes broke as hell but ive seen at least 1 person faint over her two-star celebrity ass

[sailorbrazil]

probably bought that robe on aliexpress

[iamoutofideas]

her house looks like a taco bell

[sailorbrazil]

it is

[comrade-bastard-deactivated2024]

[getoutnowdarling-blog]

I’ve made so many sims that died from woo-hooing too much

[getoutnowdarling-blog]

So the funniest thing to me is that when I was younger, like 3rd- 6th grade (yes that young) I was hooking up with girls all the time and then 9th grade rolled around and I was like “hmm am I in LGBTQ+... nahh” thinking I just wanted to be a part of it for attention. Lmao I’m dumb

[just-shower-thoughts]

Life is a lot like bread. Before you’re born, you’re being baked. When you hit puberty, you’re being toasted. When you’re getting old, you’re getting stale.

[getoutnowdarling-blog]

Let’s get this bread

[ewanmcgregorsource]

Big Fish dir. Tim Burton

[getoutnowdarling-blog]

I LOVE Big Fish

[wellyfullofale]

I think next thursday is gonna be the best day of my entire life tbh

[thequeenofsunflowers-deactivate]

reblog for next thursday to be the best day of your life

[sstudyblr]

not risking it

[owlgams]

Don’t ship real people. They’re not characters, they’re not your public property no matter how famous. They are REAL HUMAN BEINGS. Don’t be a creep.

[bensongallavich]

uhh you can still ship real people

[owlgams]

Nah.

Creep.

[getoutnowdarling-blog]

My OTP is a real couple and they’re engaged sooooo

[chickenfarmersan]

[controlthewill]

LMFAOOOOOOOO

[getoutnowdarling-blog]

Okay here’s the thing tho, that’s literally how I eat cereal.... it’s good okay

[freshbrewedlife]

[showerthoughtsofficial]

Stan Lee’s cameo for Avengers has either been shot or it hasn’t, either way it’ll be incredibly sad when it appears or doesn’t.

[getoutnowdarling-blog]

I’m hoping they’ve pre filmed a ton

[bbcsheriarty-blog]

[getoutnowdarling-blog]

Where can I read more!?

[l3sb0y]

i’m so sick and tired of people writing songs about oh*o like you realize how much youre romantizing this hell state? i’m fucking DROWNING in corn while you’re in fucking la with an acoustic trying to say all these great things about ms. worst sports teams in america and ms. THE worst college sports fans? how can you fucking miss it? once i was driving from my bby cincinnati to columbus 😒 and there were so many people preaching about the end of the year and how we needed to repent to jesus in the little towns we dropped off in i can’t fucking stand it! also people love to forget how fucking bullshit our weather is. one day can be fucking 30 degrees the next it’s like 80s and then it’s fucking snowing the next day after taht. it’s garbage! stop ducking romantizing ohio or i will threaten you with corn

[getoutnowdarling-blog]

Not if I threaten you with steel first. Hi pittsburgher here

[saintalbatross]

Reblog If Your Blog Is Safe For

Transgender people

Homosexual people

Bisexual people

Genderfluid people

Asexual people

Pansexual people

Autosexual people

Demisexual people

Bigender people

Agender people

Polysexual people

Straight people

Cisgender people

Straight allies of the lgbtqpiad community

ANYONE

[tante-toska]

I THINK I LOST A FOLLOWER FOR REBLOGGING THIS WTF