Julian Bashir's Diary

I think I'm in love with a lizard man

[julianbashirsdiary]

Dear diary,

This will be the last entry. Garak's Fall-Winter collection was a tremendous success!

We've decided to move to the Inkaria system so Garak can pursue an intergalactic career. I think he might be plotting fashion domination on the quadrant.

I'll have to pass an exam to be allowed to practice medicine. In the meantime, I'll model clothes for Garak's Spring Summer collection. Starfleet also asked if I could be on their recruitment campaign ad and the next Starfleet Illustrated Wall Calendar.

I'll miss DS9 and my friends dearly. But I'm not sad, new adventures await!

Maybe I'll even start a new diary when things settle down a bit.

[julianbashirsdiary]

Dear diary

I'm so proud Garak asked me to model clothes for his latest (last?) fashion show.

It will be a nice distraction for everyone!

[julianbashirsdiary]

36.140751_-5.353585

5.603717_-0.186964

56.949650_24.105186

52.3727598_4.8936041

-4.3217055_15.3125974

-35.2817950_149.1285341

5.320357_-4.016107

14.5907332_120.9809674

34.022405_-6.834543

45.421106_-75.690308

51.5073219_-0.1276474

46.0499803_14.5068602

36.8002068_10.1857757

47.9184676_106.9177016

-34.9058916_-56.1913095

52.5170365_13.3888599

-12.0621065_-77.0365256

41.8933203_12.4829321

30.0443879_31.2357257

59.9133301_10.7389701

23.5882019_58.3829448

Dear diary

My new friends just left and I miss them already.

I was a bit sad with the outcome of our calculations for the war's projected casualties so Lauren left a puzzle to cheer me up.

It was easy to solve and now I have to ask: is it possible to be more in love?

Garak is such a romantic!

[julianbashirsdiary]

Dear diary

Today is Jadzia and Worf's wedding. They are so in love and it means so much to see them building a life together with all their friends there to love and support them.

I hope one day it'll be me and Garak promising to love each other forever.

Then Garak can invite Worf to his bachelor party.

Garak says it's traditional for attendees to perform a pageant of the groom's family history, complete with acrobatics, costumes, and interpretive dance. I can't wait to make Worf do that.

[julianbashirsdiary]

Cannon to right of them, 

Cannon to left of them, 

Cannon in front of them 

Volley'd and thunder'd; 

Storm'd at with shot and shell, 

Boldly they rode and well, 

Into the jaws of Death, 

Into the mouth of Hell 

Rode the six hundred.

Dear Diary

Garak is sad. So am I.

[julianbashirsdiary]

Dear Diary

Sorry I’ve been away, I’ve been stuck on a planet with no space wifi it slipped my mind.

I’ve spent a lovely time on planet for once. We crashed. Garak and I had a swim.

The water was warm and Garak was so impressive!

He got captured and turned me in.

There was a poor Vorta who was very sick so Garak, helpful as ever, suggested I could be of help.

I would have anyway, but still.

Now we’re back on the Defiant. Unfortunately we don’t see much of each other these days.

I’ve been brooding.

I’m sure he’ll try to do something nice and romantic as soon as we get the station back. Better make it up to me or he can kiss his human hot water bottle good-bye.

Can’t wait!

#GraciousBoyfriend

[odospromenadebulletins]

Security would like to remind the public that Infirmary staff are professionals trying to do their jobs and the anonymous Infirmary ask box is not the appropriate way to send horny notes to the CMO. 

Security will be monitoring the situation.

[julianbashirsdiary]

[elimgaraksnotebook]

Dear Garak, you and your boyfriend should be more careful. I saw that image in the QR Kode puzzle. No, not that silly Cosmo quiz. The OTHER, more personal image. And now I have a copy saved in a VERY secure location. You wouldn't want it to get out that you were sleeping with a hew-mon, would you? But ten bars of gold-pressed latinum and a new suit might make your little problem go away.

Ah, yes.

The second QR Code.

The good doctor simply deemed it a mistake, I believe, much to my chagrin. Perhaps if I had made both interactive, instead of expecting him to spot the difference between the example given and the original challenge...

Whilst I applaud you for succeeding where Dr Bashir failed, Quark, ten bars of gold pressed latinum and a new suit seems like a high price for a problem easily solved in other, less expensive ways.

Blood stains are difficult to remove from carpets, but it is a burden I am willing to bear.

[lovemelizards]

Since you asked for it @conceptadecency

http://qrco.de/bc8opc?trackSharing=1

[odospromenadebulletins]

Garak. 

 Ensign Lovemelizards has informed me that you've been distributing intimate photographs of yourself and Doctor Bashir around the station. Is the doctor aware you're doing this? Ensign Lizards is very concerned. 

You are also in violation of several of the station ordinances regarding distribution and storage of personal materials. Station servers are not an appropriate place for your private photo collection.  I expect this to be rectified by the end of the day. 

Also, please refrain from threatening to kill Quark. He will be dealt with accordingly by the appropriate authorities.  

I'll be keeping an eye on you, Garak

[julianbashirsdiary]

Garak's been keeping pictures of us??? I can't believe it! It's so romantic!

I knew there was a heart under that thick, sexy,...

Never mind...

It's ok Odo, I won't press charges 🤩🤩🤩

[julianbashirsdiary]

Good evening, Dr Julian Sexyboy Bashir. If I were the human vestigial organ known as the appendix, would you take me out tonight?

[julianbashirsdiary]

Dear Diary

Today Garak walked me back to the Infirmary after lunch.

We stopped by a pylon to talk and he accidentally brushed my hand.

I’m never going to wash it ever again!

After work, I went back and carved J+E on the pylon.

I hope Odo didn’t see me!!!

I think he likes me (Garak, not Odo).

Scratch that. I’m sure he likes me!

[elimgaraksnotebook]

Ah, my dear doctor! 

I look back on those days with such fondness. It is always pleasant to be reminded of the little strands that entwine to become something important. It appears as though the drive for connection is within our DNA. 

And yet, who could have guessed it would happen, with you and I so different? 

There is always the risk that important details get lost in translation when we miss the start of things. Or so @ectogeo-rebubbles​, Chief of Encrypted Communications, informs me.

Did I mention that I have enlisted Chief Ectogeo’s help? I can only hope that you rise to the challenge…

cgcgaagtggaacgcagcgaagcgaacgatgatgaatgccgctatccgaccgcgggcgcgattaacgatcgctaaaattagcaagcgtactatgtaaagaaagcgccaaagcgagcgaaggtcgcctagaagaagtagcaattaccacaaaagtagttacgtcgtgcgcaagcgaagcgcttacgaaagtagtacccattaggtaagtaccgtgcgttaccacgcgcgaagtactatgtacaattatagaaggtgcgcgcgcgtaaggtagcgcaagcgaaggtagcgcaagcgcggcaattagtcgtcgcgcgtcgaaagaagcgcccaaagtacccacaattacggcaattacgcaaggcccgattatacggttagcaattaggtaagtacccacgcgcgaagtacttacgcgcgaagtagtatgta

[HINT BELOW THE CUT]

Keep reading

[lovemelizards]

I lost count of how many times I re-did this lmao I kept messing it up

Afficher davantage

[julianbashirsdiary]

Thank you for solving this while I was away Ensign Lovemelizards (what a lovely name by the way). 

You get to choose who is on night shift for the next couple of weeks. 

Of course I would have solved it myself if I hadn’t been otherwise engaged (you do realize there's a war going on Garak?) 

Have I ever told you about that time I aced my biochemistry finals? You should have expected that I - a doctor, an augment - know more than a little bit about DNA. 

Is this the best puzzle you have to offer? 

Sad...

[julianbashirsdiary]

Dear Doctor in the Anonymous Question Box,

Given that private lives seem to be the topic of the day, I have a rash around the, ahem, very privates that gets worse after a day spent in uniform.

Do you think it might be scale burn? I assume you have some experience in this area. We’ve tried to be careful, but Giloria just gets... carried away.

Butter isn’t helping.

Please advise.

Yours in xenophile hell,

LizardSlayer291

[julianbashirsdiary]

Dear Diary

Garak says I shouldn’t believe in luck but how else can you explain we’ve both been assigned to the same cabin on the Defiant?

With my odd schedule as the ship's CMO I usually have the privilege of having my own assigned quarters.

It must be a sign! We’re meant to be together!

Today Garak hurt his head. I don’t really know how because the injury isn't consistent with his description of the accident.

I suspect he was just feeling lonely and wanted to see me.

He didn’t lose time riling me up! Pure Cardassian flirting. Fortunately we were alone in sickbay.

He said my smile was not so boyish anymore! Can you believe it?

Of course I had to prove him right away I was still young, thank you very much, so we did it on the floor.

It was so romantic! Two lonely souls brought together by war and shitty fathers.

#AndWeWereRoommates

[julianbashirsdiary]

[julianbashirsdiary]

[elimgaraksnotebook]

My Dear Doctor, 

 I thought I had already seen the depths to which Human literature could sink, and yet I stand mistaken. Though the magazine calls itself Cosmopolitan, the contents within, I assure you, could be thought of as anything but. 

His Butt: What the Size, Shape, and Pinchability of Those Sweet Cheeks Reveal About His True Self 

 99 Sexy Ways to Touch Him: These Fresh, Frisky Tips Will Thrill Every Inch of Your Guy (Our Favorite Requires a Glazed Donut) 

Are You Good-Girl Hot, Or Bad-Girl Hot? 

I can only assume this is some sort of code. 

 Speaking of which...

INTERACTIVE PUZZLE

[julianbashirsdiary]

From: @julianbashirsdiary

To: @elimgaraksnotebook

Subject: Hacking and stealing

My love My dear friend with benefits

Garak,

While I do enjoy a good puzzle like the next augment, I admit I’m a bit disappointed.

You must have really low expectations if you believe this was in any way challenging.

Since I’m taking precious minutes out of my busy schedule to write this, could I also ask you to stop stealing my Cosmo?

You probably won’t but could you just not do the quiz before I have time to do them myself?

Anyway. I miss you terribly, I’ll stop by as soon as I can get a break.

Love Best,

Julian

Attachment:

[julianbashirsdiary]

[julianbashirsdiary]

Dear Diary

You won't believe what happened today. I was duplicating your content on a pad to take you with me when we evacuate the station and the pad suddenly blinked with all sorts of warnings.

Can you believe someone hacked you?

I just had the time to check the oldest altered file because I had to prepare the Defiant sickbay. I put you down on my desk and when I came back, Ensign Victory had solved the encryption!

It was the loveliest message!

I'm blushing just thinking about it.

I had no idea Garak found me attractive when we first met. I would have gladly licked his spoon back then.

I have to go now, we've received our orders. I have no idea where Garak will go. I'm so worried about him. But he's strong, he'll probably outlive us all.

This is so EXCITING!

The spy was spying on ME!

[julianbashirsdiary]

Dear Doctor Bashir,

I heard through the kana vine that you were flirting with a certain disgusting 'tailor' during that unfortunate incident with the security system lockdown on the station. Please tell me my reliable source was imagining things. Garak's a horrible, lying little vole and even a human like you can do better. (I also heard he accused Gul Dukat of flirting with Major Kira, and of course Dukat is an honourable man and would never betray his marriage vows.) If I were you, I'd watch who you align yourself with, Doctor.

Signed,

A Friend

Dear anonymous person

The events you’re referring to happened quite a long time ago.

I do remember them though.

Our brave tailor could have left anytime but chose to try to save us from the tragic fate a totally irresponsible Gul had brought upon us.

What you took for flirting was mere admiration on my part.

Had we been alone, we probably would have made it on the floor one first-last time just in case we didn’t make it.

Anyway, thank you for your message.

Not that it’s any of your business.

Best Regards

Dr Julian S. Bashir, DS9 CMO