A Mistake

H aH

[barbarella-deactivated20211107]

things i wish made it into the movie

roger’s cupboard

kenny everett playing bohemian rhapsody 14 times in two days

DAVID BOWIE

deacy composing the ‘under pressure’ bassline, going out for pizza, and forgetting it

getting stuck in the elevator after borhap hits number 1

deacy’s monochromatic early 80s outfits

roger accidentally selling freddie’s jacket

BRIAN HAROLD MAY PLAYING THE UKULELE

deacy throwing peanuts at brian during his brighton rock solo

the new orleans jazz party nobody can remember

the boys sharing clothes

more of roger’s falsetto

jim playing with freddie’s cats while everyone else in the house was high on cocaine

freddie (supposedly) dressing princess diana in drag and sneaking her into a gay bar

the time deacy got drunk and forgot what band he was in

brian and roger having a huge argument and stopping when they stumbled on freddie eating cereal in his underwear

[aaitwo-deactivated20250816]

emotionally im doing the laminated paper wobbling sound

[offbrand-yogurt-blog]

Me too

[everydaylouie]

happy halloween! here is a ghost duet

[trappedblackrose-deactivated201]

I love this so much. I always play it when it comes on

[c0litasxo]

how cute

[mwg-drwg]

Incase anything happens to my account here’s my entire genome:

GATTTACTCGTACGGTACGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGYTTCCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATTAOCGGTACGATCCCGTAGGGTAGGGGGTTAATTGGCTCTGAGGGTTCTYCTCAATCCTCAATCAATCCTCHUATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGAATTCCAATCAATCCTCAATCATCAATCAACTCKAATCAATCCTCHATCTNACCCCCTTTAFCOGATCCCGTAGGGTAGGATCCTCATCTACCCTTCCTTTAFCGATCCCGTAGWGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTGATTTACTCGTACGGTACGATCCCGTAGGGTAGGGGGTTAAGGCTCTGIAGGGTTCCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGHCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATTACGGTACGATCCCGTAGGGTAGGGGGTTAATTGGCTCTGAGGGTTCTYCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCACGTAGGGTAGGGGGTTAAGGCTCTGAGGGAATTCCAATCAATCCTCAATCATCAATCAACTDCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCATCTACCCTTCCTTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTCATCTACCCCCTTTAFCGATOCCCGTAGGGTAGHGCCTCAATCATCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCHATCTACCCCCTTTAFCGATCCCGDTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCATCTACCCCCTTTAFOCGATCCCGTAGGGTAGHGCCTCAATCATCAATCCTCAATCCTTTAFCGATCCCGTAGGGTIAGGATCCTCATCTACCTCTTCCTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAOATCCTCTCAATCCTCAATCAATCCTCATCTACCCCCTTTAFCGATCCCGTAGGGTAGHGCCTCAATCATCAATCCETCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCATCTACCCCCTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTMTCCAATCAATCCTCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGG…

[monkeysky]

You got like six unique nucleotides so nice

[deepspacepirate]

OP is a virus from outer space

[deepspacepirate]

FUCK YOU OP

[reanimateobjects]

I picked up a worm, and it wrote something in my hand with a tiny pencil. Unfortunately it was too small to read. An autograph? A spell? An angry note?

[sake-pls]

@reanimateobjects I’ve decided to line up with their writing and whatever they wrote appear to be…. phallic. I don’t how to break the news with you, but, I think that worm drew a penis on your hand…. Congratulation?

[reanimateobjects]

Ooh! Thank you for this valuable contribution to the field of worm linguistics and/or art. It is still unclear to me if it’s meant as a rude message to me, if it’s just putting its tag there, or something else. Further research is needed!

[anraich-deactivated20181203]

I think the idea of it being a penis is anthropomorphism. I mean, the worm doesn’t have a penis itself, nor proper eyes with which to see one. No, I’m afraid this is something far more interesting: a self-portrait. You have been touched by an aesthetic annelid, and now your life will never be the same.

[reanimateobjects]

Now I will forever try to communicate with all the worms I find, but I worry that I’ll never meet this one again.

[rollerskaq]

My name is Werm I liv in ground And thru the darck I skwirm around

The peepl tell me All the tym I’m farr too yuck With too much slym

But I think Werm Is gud to be. I find a styck

I draw a me

[thesunshinegrl]

I love twenty one pilots

[racing-faster]

[fuks]

[yuckypearls]

The Crain Children of Hill House

[float-autumn-leave-deactivated2]

My precious boys❤

[eggsaladstain]

baby luke is such a good boy and i would die for him honestly

look at him !!!

[alfiessolomvns]

You have to say your name so I know it’s really you. Ugh. Luke Crain!

[aaronsboots-deactivated20190312]

[float-autumn-leave-deactivated2]

*Cries in Abigail deserved beter language*

[float-autumn-leave-deactivated2]

Julian wishing Oliver a Happy birthday on instagram!

WHY SO CUTE? WHYYY????

[aisforalive-blog1]

Carla Gugino answers some burning questions from The Haunting of Hill House

[midge-maisel]

[offbrand-yogurt-blog]

Slurp