stay determined!

is there anything life can throw at me that i can't conquer with style and ease?

[norikouemoto]

I want to take you home！

[cosmostickers]

by mizunon

[thegroovyarchives]

Mid-Century Snoopy & Woodstock Valentines (x)(x) (x)(x) (x)(x)

[garlands-jpn-deactivated2025022]

seymour chwast

[clearly-blurred]

baby animals

[newjackcole]

Split in the Tracks

[artist-sargent]

Atlas and the Hesperides, 1925, John Singer Sargent

Medium: oil,canvas

[ultrakillblast]

ROBOCOP (1987)

[papasmoke]

Please list your full genome sequence in your bio

[papasmoke]

Louis | 24 | Bi | They/Them | GATTACATACCTTACTTATTACCGATAGGGCAGATTACGGACCTATTAGATTACATAGATAGGGGAAAAAACATAGATACATACGTAGTTGCTCGACACTAGATTACAGATACTAATATTTTGATACCCAGGTTAGACGATTACAGATTACATTACAGGATACCGATGAGGATAGGACGATTACATACCTTACTTATTACCGATAGGGCAGATTACGGACCTATTAGATTACATAGATAGGGGAAAAAACATAGATACATACGTAGATTACATTAGACCATAGGTTGCTCGACACTAGATTACAGATACTAATATTTTGATACCCAGGTTAGACGATTACAGATTACATTACAGGATACCGATGAGGATAGGA | White

[papasmoke]

People are telling me that this genome sequence is "too short" and "doesn't match any known organism" and if my genome looked like that i would be "dead" but maybe those people simply haven't optimized their genomes like I have

[bakwaaas]

[wool-skirt-deactivated20240106]

had a dream i used a celtic harp as a bow

[cheapetsy]

cat stamps // $5.50

[renaissance-art]

[bigglyboof]

bowtie raichu! 

[b3opal]

하이레츠~!

[valtsv]

woman in a victorian novel: *develops a fever from worrying too much*

me, shivering and sweating with stress-induced anxiety: wtf that’s so unrealistic lol

[xelbleedsglitter]

screaming at self to paint the fucking deer already

[xelbleedsglitter]

Here’s the fucking deer.

[xelbleedsglitter]

I scanned the fucking deer.  I might post him properly on my art account, but here he is clearer for anyone that wanted to see.