Following you is so amazing because I could just be reading an already random or normal post and directly below it is a computer voice saying letters and then a picture of a snail
String identified: gaagcactagaaaaatacttactcagttatactaa
Closest match: Cabera pusaria genome assembly, chromosome: 9 Common name: Common White Wave
(image source)













