Tumblr Genetics

finding tumblr's genome one post at a time

[hellsitegenetics]

WARNINGS / FAQ / REQUESTS

asks are open! check here before sending :) (updated 4/17/2025) consider helping me pay to finish my education!

banned from BLAST for being too sexy trans supportive forever

check out the archive of every creature that has appeared! (archive maintained by @i-am-the-plagu3)

CREATURE WARNING:

this blog posts BEASTIES and ORGANISMS. if you are uncomfortable with seeing any manner of organism (spiders, rodents, fish, etc) please block the tags for that organism before following/browsing. for broad categories: i tag in plurals (insects, bugs, spiders, fish, rodents, parasites, pathogens, plants, trees, worms, etc.) for specific organisms: i tag in singulars (dobsonfly, eurasian harvest mouse, etc.) for disease causing bacteria: i tag the illness it causes (malaria, botulism, etc.) for additional phobias: i tag with the specific phobia ("tw trypophobia", etc.) FOR FLASHING LIGHT SENSITIVE USERS: any gifs i post are tagged with "gifs," and any fast-moving or flashing gif/video will be tagged with "flashing". FOR SCREENREADER USERS: by the nature of this blog, 99% of my posts will have large sections of unformatted letters, and therefore aren't very screenreader friendly. i apologize. If I ever miss a tag or you'd like to request that I tag something, please send me a message.

FREQUENTLY ASKED QUESTIONS:

Are you a bot?: no, just neurodivergent

How do you do this?: i delete everything in a message except for the letters A, T, C, and G. then, i BLAST it with my powers.

Are you Italian?: according to democracy, yes

How do I request things?: read the REQUESTS section of this post :)

Why are there so many bugs???: 1. insects make up almost 80% of all animal life on earth 2. they are relatively easy to study, so there's more bug DNA in the BLAST database.

Okay but why so many MOTHS???: because scientists are not immune to bias. moths are pretty looking and easy to study, so there is more moth DNA in the BLAST database.

Do the punctuation marks/emojis mean anything to BLAST?: no, i just keep them there after my first pass of a text so you can easily recognize i'm using that same text to find an organism.

Can I send in general questions?: yes! but they may get BLASTed.

Why are you marked red on shinigami eyes?: i have no fucking idea dude. but if you want to check my blog for how i talk about trans folks, you're more than welcome to.

I'm checking your work, but I'm not getting the same results. Why? im using nr/nt, the old database, rather than core_nt. this is probably why you're getting different results :)

REQUESTS:

to request something, please read this section and then send an ask. asks that don't follow these guidelines will be deleted, and may get you blocked.

For questions: make sure it hasn't been already answered in the FAQ, then send.

For songs, poetry, bible verses, or otherwise long text (over 1500 characters, or text with a lot of spacing): send a link to the text or a pastebin with the text in it.

For Tumblr posts: send a link.

For other languages: make sure it's romanized (in latin script), then send.

REQUESTS I WILL NOT ANSWER:

things i have already answered. search the blog for whatever you're about to submit, and check the Frequently Requested section before sending.

private information (name, address, etc. YES people have tried this.)

AAAAAAAAAAA, GATCAGTCAGATTCCGACGGT, CATCATCATCAT, etc. get creative with it.

spam. (if i don't answer a request after a long time, feel free to send it again-- just not 5 times, please)

homestuck

FREQUENTLY REQUESTED:

The Bee Movie Script, navy seals copypasta, AM hate monologue, All Star, Yoshikage Kira, Never Gonna Give You Up, man door hand hook car door, Big Bill Hells, FNAF Connection Terminated, JURGEN LEITNER, Eggman's Announcement, Free Bird, Spiders Georg, Weed Smoking Girlfriends, Ebony Dark'ness Dementia Raven Way, Minos Prime, Steamed Hams, battery acid spaghetti, everyone get unemployed, squidward is nonbinary, What is a man?, fucking military wives, (this list will be updated as we go!)

thank you for reading! as a treat, enjoy this Lamprocapnos spectabilis, or Bleeding Heart flower.

[saintmelangell]

[hellsitegenetics]

String identified: a ta t a ag g. a ttc t ta cat a. c tg Tat ta a c T Ga A gt. a a. . a.

Closest match: Lagria hirta genome assembly, chromosome: 2 Common name: Rough-Haired Lagria Beetle

(image source)

[datadegroove-deactivated2026042]

I will NEVER deactivate. and how DARE you

[hellsitegenetics]

String identified: ta gg t "t actatg" #T c c actat actat. a A

Closest match: Aphelia paleana genome assembly, chromosome: 14 Common name: Timothy Tortrix

(image source)

[hellsitegenetics]

hiihi uhm genetics and dna is one of my special interests and it is wild to me i've never seen this blog before and my excitement was intensified tenfold learning you're NOT A BOT!!!! This is so important to me!!

String identified: gtc a a ca tt a t t ' t g a ctt a t t ag ' T A T!!!! T tat t !!

Closest match: Orthostixis cinerea genome assembly, chromosome: 14

(image source)

[misidentifying-animals-in-posts]

best animal names: unnecessarily judgemental edition

[nae-nae-supreme]

when someone mentions HOES with ARMPIT HAIR

[jame7t]

its 10 AM on a weekday .

[balaclava-trismegistus]

Isn't there an industrial boiler you're supposed to be maintaining

[nae-nae-supreme]

I must find...the HOES.

,whatever it takes

[hellsitegenetics]

String identified: t t AT A t A a a . 't t a ta ' t atag t …t . ,at t ta

Closest match: Scolopendra cretica genome assembly, chromosome: 5 Common name: Cretan Giant Centipede

(image source)

[hellsitegenetics]

[nae-nae-supreme]

when someone mentions HOES with ARMPIT HAIR

[jame7t]

its 10 AM on a weekday .

[balaclava-trismegistus]

Isn't there an industrial boiler you're supposed to be maintaining

[nae-nae-supreme]

I must find...the HOES.

,whatever it takes

[hellsitegenetics]

String identified: t t AT A t A a a . 't t a ta ' t atag t …t . ,at t ta

Closest match: Scolopendra cretica genome assembly, chromosome: 5 Common name: Cretan Giant Centipede

(image source)

[reallyreallyreallytrying]

(eating a pill i found on the floor of the club bathroom) hope it's a placebo. i don't need any effects right now

[hellsitegenetics]

String identified: (atg a t t c at) t' a ac. 't a ct gt

Closest match: Ovis aries breed Hu sheep isolate HU3095-Father chromosome 8 Common name: Sheep

(image source)

[catmask]

does a single vivziepop character leave the onceler BMI bracket or are they all build like garden shed tools

[jellyfishesarecooler]

none of these words are in the bible

[catmask]

oh yes they are

[hellsitegenetics]

String identified: a g caact a t c act a t a ga t t a t a t ga t a

Closest match: Symphodus rostratus genome assembly, chromosome: 15 Common name: Pointed-Snout Wrasse

(image source)

[necrowtic]

is it really possible for a girl to eat a burger....

[necrowtic]

ourger -> 🍔

[hellsitegenetics]

String identified: t a a g t at a g…. ag at t a t cg c t' t a cct t a t c tat at a g t c t t t at a at a ct t atg cat t a g -> 🍔

Closest match: Anthopleura xanthogrammica genome assembly, chromosome: 4 Common name: Giant Green Sea Anemone

(image source)

[hellsitegenetics]

Hello! What is your opinion on the category commonly known as fish? Are we fish or are cartilaginous fish not fish? I wonder if there are more species with ‘fish’ in the name that aren’t fish than are…

this is the ichthyology equivalent of putting a pipe bomb in my mailbox

[calebwittebane]

ok everyone time to start laying eggs

[the-frightening-ghoul]

‎

[calebwittebane]

time to start laying eggs, frightening ghoul

[the-frightening-ghoul]

‎

[the-frightening-ghoul-jr]

‎

[calebwittebane]

this is how blogging can have a huge impact on the lives of people and ghouls

[hellsitegenetics]

String identified: t t tat ag gg t t tat ag gg, gtg g t ggg ca a a g act t a g

Closest match: Cephalopholis fulva genome assembly, chromosome: 18 Common name: Coney

(image source)

[hellsitegenetics]

i'm sure other people use BLAST but when the site's down i like to imagine they're targeting you specifically

the NIH made BLAST for me to play with i just let all the scientists use it because i'm nice

[hellsitegenetics]

[hellsitegenetics]

i'm sure other people use BLAST but when the site's down i like to imagine they're targeting you specifically

the NIH made BLAST for me to play with i just let all the scientists use it because i'm nice

[echokelly]

I love it when people describe something that's too big as "fuck off". like this thing is so large. leave.

[hellsitegenetics]

String identified: t c tg tat' t g a "c ". t tg ag. a.

Closest match: Halichoeres bivittatus genome assembly, chromosome: 3 Common name: Slippery Dick

(image source)

[katjohnadams]

[hellsitegenetics]

hello lovely tumblr user, i was wondering if you or your followers are aware of any other science based gimmick blogs? i love actually getting to learn more physics and biology and stuff through following sciencey ppl on here! i need More!!! thanks!

if we're talking gimmick blogs specifically, the only ones i'm really aware of (that are still active) are hellsite-proteins and identifying-cat-phenotypes. of course, there's also a lot of "identifying-x" gimmick blogs that take photos of animals and identify the species, which is also very cool!

if anyone knows of any others, please do share.

i also want to encourage people who are interested in making sciency gimmick blogs to do so. talking about science in a community of nerds online is probably the most fun i've had in this field!

[hellsitegenetics]

dna results came back positive

a

String identified: a

Closest match: ADENINE!!!