Help spread the word: Obamacare deadline for health care coverage in 2019 is December 15. Pass it on.

No title available

ellievsbear

No title available
DEAR READER
Stranger Things

Discoholic 🪩
h

JBB: An Artblog!
Alisa U Zemlji Chuda

Andulka
Today's Document
"I'm Dorothy Gale from Kansas"
PUT YOUR BEARD IN MY MOUTH
No title available
noise dept.
RMH
🪼

oozey mess
Xuebing Du
Misplaced Lens Cap

seen from Switzerland

seen from Malaysia
seen from United Kingdom
seen from Denmark
seen from France
seen from United Kingdom
seen from Argentina

seen from United Kingdom
seen from Hong Kong SAR China

seen from T1
seen from United Kingdom
seen from United States

seen from Türkiye
seen from Türkiye

seen from Germany
seen from T1

seen from Malaysia

seen from United States
seen from United Kingdom
seen from United States
@donkeymkong
Help spread the word: Obamacare deadline for health care coverage in 2019 is December 15. Pass it on.
Reblogging this once more because my mom and I legitimately laughed to tears.
this is my favorite video on the internet
mental health tip: save this video. watch it when you’re sad. it’s the best goddamn thing on the internet
Does anybody remember this “go nuts, show nuts, whatever” gem? Oh how the mighty have fallen.
You either die a hero or live long enough to see yourself become a villain
Incase anything happens to my account here’s my entire genome:
GATTTACTCGTACGGTACGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGYTTCCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATTAOCGGTACGATCCCGTAGGGTAGGGGGTTAATTGGCTCTGAGGGTTCTYCTCAATCCTCAATCAATCCTCHUATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGAATTCCAATCAATCCTCAATCATCAATCAACTCKAATCAATCCTCHATCTNACCCCCTTTAFCOGATCCCGTAGGGTAGGATCCTCATCTACCCTTCCTTTAFCGATCCCGTAGWGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTGATTTACTCGTACGGTACGATCCCGTAGGGTAGGGGGTTAAGGCTCTGIAGGGTTCCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGHCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATTACGGTACGATCCCGTAGGGTAGGGGGTTAATTGGCTCTGAGGGTTCTYCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCACGTAGGGTAGGGGGTTAAGGCTCTGAGGGAATTCCAATCAATCCTCAATCATCAATCAACTDCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCATCTACCCTTCCTTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTCATCTACCCCCTTTAFCGATOCCCGTAGGGTAGHGCCTCAATCATCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCHATCTACCCCCTTTAFCGATCCCGDTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCATCTACCCCCTTTAFOCGATCCCGTAGGGTAGHGCCTCAATCATCAATCCTCAATCCTTTAFCGATCCCGTAGGGTIAGGATCCTCATCTACCTCTTCCTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAOATCCTCTCAATCCTCAATCAATCCTCATCTACCCCCTTTAFCGATCCCGTAGGGTAGHGCCTCAATCATCAATCCETCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCATCTACCCCCTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTMTCCAATCAATCCTCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGG…
You got like six unique nucleotides so nice
OP is a virus from outer space
FUCK YOU OP
THIS IS THE WORST THING
If there’s anything worth living for, it’s kittens trying to imitate their moms.
PEAS 🦆
thank you so so much for sharing this. this video is so important to me. i would sell my laptop, my house, and my sister for this duck. this video has enlightened me. i can continue living knowing such a being exists. thank you.
i just went on r/incels to see if it was really that bad and it was actually pretty informative. i found out that women are all powerful beings and we control society by exploiting men for their money and their jobs, are NOT required to pay bills, and that we all make 50k a month on patreon. like shit why did no one tell me. i didnt even know i had a patreon
my grandma’s watching fox news and i’m overhearing then losing their absolute shit over millennials not buying kraft singles
let’s be real though, it deserves to die.
it doesn’t taste anything like cheese.
Its not even allowed to be branded as “cheese” in most countries outside the US
Mess
This is just…nah, this ain’t right.
this is grindr. why are you all so surprised?
Reblogging mostly for the Yzma gif.
an actual video of me in any math class ever.
crying at what someones tagged this
glaswegian ya fool
Hans Hemmert
this feels like a furry thing
“hey bro whats your fursona” “vague yellow mass”
it’s not implausible and you know it
powerful energies to ward off negativity in 2018