My Favorites

Things I find funny, cute, true, or beautiful - Instagram/Snapchat: iamdmk7

[liberalsarecool]

Help spread the word: Obamacare deadline for health care coverage in 2019 is December 15. Pass it on.

[shavingryansprivates-deactivate]

[dopenmind]

Reblogging this once more because my mom and I legitimately laughed to tears.

[idiotlibra]

this is my favorite video on the internet

[hashtagloveloses]

mental health tip: save this video. watch it when you’re sad. it’s the best goddamn thing on the internet

[catsofinstagram]

[the-stickers]

[ontarom]

Does anybody remember this “go nuts, show nuts, whatever” gem? Oh how the mighty have fallen.

[mudaship39]

You either die a hero or live long enough to see yourself become a villain 

[mwg-drwg]

Incase anything happens to my account here’s my entire genome:

GATTTACTCGTACGGTACGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGYTTCCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATTAOCGGTACGATCCCGTAGGGTAGGGGGTTAATTGGCTCTGAGGGTTCTYCTCAATCCTCAATCAATCCTCHUATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGAATTCCAATCAATCCTCAATCATCAATCAACTCKAATCAATCCTCHATCTNACCCCCTTTAFCOGATCCCGTAGGGTAGGATCCTCATCTACCCTTCCTTTAFCGATCCCGTAGWGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTGATTTACTCGTACGGTACGATCCCGTAGGGTAGGGGGTTAAGGCTCTGIAGGGTTCCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGHCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATTACGGTACGATCCCGTAGGGTAGGGGGTTAATTGGCTCTGAGGGTTCTYCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCACGTAGGGTAGGGGGTTAAGGCTCTGAGGGAATTCCAATCAATCCTCAATCATCAATCAACTDCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCATCTACCCTTCCTTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTCATCTACCCCCTTTAFCGATOCCCGTAGGGTAGHGCCTCAATCATCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCHATCTACCCCCTTTAFCGATCCCGDTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCATCTACCCCCTTTAFOCGATCCCGTAGGGTAGHGCCTCAATCATCAATCCTCAATCCTTTAFCGATCCCGTAGGGTIAGGATCCTCATCTACCTCTTCCTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAOATCCTCTCAATCCTCAATCAATCCTCATCTACCCCCTTTAFCGATCCCGTAGGGTAGHGCCTCAATCATCAATCCETCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCATCTACCCCCTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTMTCCAATCAATCCTCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGG…

[monkeysky]

You got like six unique nucleotides so nice

[deepspacepirate]

OP is a virus from outer space

[deepspacepirate]

FUCK YOU OP

[catchymemes]

[thrussy]

[highkeygay]

THIS IS THE WORST THING

[basketballamerican-deactivated2]

[smitethestate]

If there’s anything worth living for, it’s kittens trying to imitate their moms.

[catchymemes]

[neoperks]

PEAS 🦆

[c-rowteeth]

thank you so so much for sharing this. this video is so important to me. i would sell my laptop, my house, and my sister for this duck. this video has enlightened me. i can continue living knowing such a being exists. thank you.

[theliberalstookmydrills]

[chandra-nalaar]

i just went on r/incels to see if it was really that bad and it was actually pretty informative. i found out that women are all powerful beings and we control society by exploiting men for their money and their jobs, are NOT required to pay bills, and that we all make 50k a month on patreon. like shit why did no one tell me. i didnt even know i had a patreon

[johnnyjoestarrelatable]

my grandma’s watching fox news and i’m overhearing then losing their absolute shit over millennials not buying kraft singles

[johnnyjoestarrelatable]

[durgeth]

let’s be real though, it deserves to die.

[worldsspecialestboy]

it doesn’t taste anything like cheese.

[axelinabox]

Its not even allowed to be branded as “cheese” in most countries outside the US

[manhub]

Mess

[salty-red-mage]

[c3nric-deactivated20220627]

This is just…nah, this ain’t right.

[gisforgregorryyy]

[romy7]

[upside-happenings]

this is grindr. why are you all so surprised?

[prongsthepart-timejedi]

Reblogging mostly for the Yzma gif.

[deepdickpizza]

[king-garbo-deactivated20190103]

an actual video of me in any math class ever.

[daughter-ofthesea-deactivated20]

crying at what someones tagged this

glaswegian ya fool

[darksilenceinsuburbia]

Hans Hemmert

[minervafloofderg-migrating]

this feels like a furry thing

[scaliepost-generator]

“hey bro whats your fursona” “vague yellow mass”

[minervafloofderg-migrating]

it’s not implausible and you know it

[yigah-moved-deactivated20181217]

powerful energies to ward off negativity in 2018