Local Worldbuilding Nerd

Logic is overrated.

[i-am-a-fish]

whose dumb ass idiot fuck idea was it to make medicine cost money

[i-am-a-fish]

go to triple hell

[lovewillbreakyourheartforever]

[lovewillbreakyourheartforever]

[hellsitegenetics]

String identified: a ta t a ag g. a ttc t ta cat a. c tg Tat ta a c T Ga A gt. a a. . a.

Closest match: Lagria hirta genome assembly, chromosome: 2 Common name: Rough-Haired Lagria Beetle

(image source)

[auspex]

*thinks about OCs* *Thinks about OCs* *thinks about OCs* *thinks About OCs* *thinks about OCs* *Thinks About OCs* *thinks about OCs* *THINKS ABOUT OCS* *thinks about OCs* *thinks about OCS* *thinks about OCs* *THINKS about OCs* *thinks about OCs* *thinks ABOUT OCs* *thinks about OCs* *thinks about OCs* *Thinks about OCs* *thinks about OCs* *thinks About OCs* *thinks about OCs* *Thinks About OCs* *thinks about OCs* *THINKS ABOUT OCS* *thinks about OCs* *thinks about OCS* *thinks about OCs* *THINKS about OCs* *thinks about OCs* *thinks ABOUT OCs* *thinks about OCs*

[auspex]

*thinks about OCs* *Thinks about OCs* *thinks about OCs* *thinks About OCs* *thinks about OCs* *Thinks About OCs* *thinks about OCs* *THINKS ABOUT OCS* *thinks about OCs* *thinks about OCS* *thinks about OCs* *THINKS about OCs* *thinks about OCs* *thinks ABOUT OCs* *thinks about OCs* *thinks about OCs* *Thinks about OCs* *thinks about OCs* *thinks About OCs* *thinks about OCs* *Thinks About OCs* *thinks about OCs* *THINKS ABOUT OCS* *thinks about OCs* *thinks about OCS* *thinks about OCs* *THINKS about OCs* *thinks about OCs* *thinks ABOUT OCs* *thinks about OCs*

[i-am-a-fish]

we are so back. no new developments I just have a gut feeling

[i-am-a-fish]

new development, anything can change. everything's possible. I had a really good day today

[melancholygirls]

I passed a flower shop next to a tattoo shop and at first I laughed because I thought it was ironic and then i freaked because IMAGINE YOUR OTP IN A FLORIST/TATTOO ARTIST AU

[stillalittlekid]

OMG I COULD TOTALLY IMAGINE THEM LIKE THAT IT WOULD BE SO PERFECT

[christ-with-a-why]

[hellsitegenetics]

String identified: a a t t a tatt a at t ag ca tgt t a c a t a ca AG T A T/TATT ATT A G C TTA AG T TAT T CT T ac tt!

Closest match: Hottonia palustris genome assembly, chromosome: 9 Common name: Water Violet

(image source)

[i-am-a-fish]

the sleepy -> cozy -> asleep pipeline is very real

[uwuppa]

plushie wife who biologically doesnt need food but still wants snacks

[writing-prompt-s]

“Don’t touch it! That’s the corpse of a god.”

[eeveemaster547]

Kagrenac, about to create one of the most mysterious events of the timeline:

[naedocytebreeder]

[squeakitties]

Visit Original Link

[squeakitties]

can i feed u marbles

<- so full of marples

[i-am-a-fish]

posture check! time to make your posture worse. it can always be worse. you can get shrimpier. inspiration if you need it:

[hellsitegenetics]

a group of geneticists walk into a bar. t a a ga at a t a

String identified: a g gtct a t a a. t a a ga at a t a

Closest match: Vitis vinifera genome assembly, chromosome: hap1_18 Common name: Wine Grape

(image source)

[nyancrimew]

[hellsitegenetics]

String identified: aa a: ATGCGATATGCGCGATGCGATAGCGACAC, t gg a a tt a

Closest match: Agonopterix yeatiana genome assembly, chromosome: 15 Common name: Coastal Buff

(image source)

[eeveemaster547]

Okay but I have to know what the actual sequence they used is closest to

[kittyb1tz]

"um this song is actually about masturbation!!!!!!!!" aw thats so scary :( do you wanna call your mummy (remembers how americans read that) do you wanna call your strong as fuck ice mummy

[hellsitegenetics]

String identified: " t g acta at atat!!!!!!!!" a tat ca :( aa ca ( aca a tat) aa ca tg a c c

Closest match: Atropa bella-donna genome assembly, chromosome: 11 Common name: Deadly Nightshade

(image source)

[isopod-girl-antenna]

Do you wanna call your strong as fuck poison mummy?

[hellsitegenetics]