Local Worldbuilding Nerd

Logic is overrated.

[i-am-a-fish]

posture check! time to make your posture worse. it can always be worse. you can get shrimpier. inspiration if you need it:

[hellsitegenetics]

a group of geneticists walk into a bar. t a a ga at a t a

String identified: a g gtct a t a a. t a a ga at a t a

Closest match: Vitis vinifera genome assembly, chromosome: hap1_18 Common name: Wine Grape

(image source)

[nyancrimew]

[hellsitegenetics]

String identified: aa a: ATGCGATATGCGCGATGCGATAGCGACAC, t gg a a tt a

Closest match: Agonopterix yeatiana genome assembly, chromosome: 15 Common name: Coastal Buff

(image source)

[eeveemaster547]

Okay but I have to know what the actual sequence they used is closest to

[kittyb1tz]

"um this song is actually about masturbation!!!!!!!!" aw thats so scary :( do you wanna call your mummy (remembers how americans read that) do you wanna call your strong as fuck ice mummy

[hellsitegenetics]

String identified: " t g acta at atat!!!!!!!!" a tat ca :( aa ca ( aca a tat) aa ca tg a c c

Closest match: Atropa bella-donna genome assembly, chromosome: 11 Common name: Deadly Nightshade

(image source)

[isopod-girl-antenna]

Do you wanna call your strong as fuck poison mummy?

[hellsitegenetics]

[hellsitegenetics]

[foone]

[pukicho]

You arw a microorganism

[hellsitegenetics]

String identified: a a cga

Closest match: You!

[hollowboobtheory]

if you are a game designer and you force me to kill wolves AND you have them make sad puppy noises I'm killing you

[choicelessflope]

see this never happens in spider solitaire for windows

[clowngirlpony]

Think again

[hellsitegenetics]

String identified: a a ga g a c t A a t a a ' g t a ta T aga

Closest match: Trionyx triunguis genome assembly, chromosome: 20 Common name: African Softshell Turtle

(image source)

[foolishorluffyswife]

[hellsitegenetics]

i'm sure other people use BLAST but when the site's down i like to imagine they're targeting you specifically

the NIH made BLAST for me to play with i just let all the scientists use it because i'm nice

[hellsitegenetics]

[calebwittebane]

ok everyone time to start laying eggs

[the-frightening-ghoul]

‎

[calebwittebane]

time to start laying eggs, frightening ghoul

[the-frightening-ghoul]

‎

[the-frightening-ghoul-jr]

‎

[calebwittebane]

this is how blogging can have a huge impact on the lives of people and ghouls

[ufo-encounter]

*flies past*

[ufo-encounter-jr]

* ᶠˡᶦᵉˢ ᵖᵃˢᵗ*

[necrowtic]

is it really possible for a girl to eat a burger....

[necrowtic]

ourger -> 🍔

[hellsitegenetics]

String identified: t a a g t at a g…. ag at t a t cg c t' t a cct t a t c tat at a g t c t t t at a at a ct t atg cat t a g -> 🍔

Closest match: Anthopleura xanthogrammica genome assembly, chromosome: 4 Common name: Giant Green Sea Anemone

(image source)

[wumblr]

all of the numbers that are divisible by 17 sound so absurd. 51? 68? 85? ridiculous. 102? absolutely not. and don't even get me started on 119

[wumblr]

34 and 136 i can believe, but i feel like i shouldn’t. it’s 102 in a trench coat

[red-swimmerz-deactivated2021082]

did we just run out of posts to make

[wumblr]

no, i haven't made a post about every number yet

[swinginsportscutebasketball]

I'm sorry to let you know that 100,000,001 (one hundred million and one) is divisible by 17 and because of that, so is every 16-digit number that is four digits repeated four times e.g. 1234123412341234

[wumblr]

[greatgreatauntie]

But 100,000,001 very much isn't divisible by 17

[wumblr]

[asterrisms]

as a pink lover. The ""universal""" hatred of the color pink by young girls is due to the heavy expectation of femininity forced on them. It is an expression of frustration at gender roles. It is not internalized misogyny. No you will not inevitably start liking pink as an adult and if you do that is not healing your inner divine feminine or whatever we're saying now. Its a color. 😁👍

[yellow-cat]

here's my cat for your dash btw. if you even care

[one-time-i-dreamt]

I care very much

[defectivegembrain]

Oh so when Clifford the Big Red Dog grows to enormous size you love and accept him, but when I, Fenrir

[kirkspocks]

odin is like “when thor was born the sun shone bright upon his beautiful face. i found loki on the sidewalk outside a taco bell”

[chromalogue]

Oðinn spake:

Bright the sun shone | at the time of Þor’s birth, And bathed his count'nance fair. Loki, wolf-father, | the trickster, the liar, I found on the cold pavement While returning in glory | from a grand hunt For a 3 AM quesadilla.

[baegishjalmur]

@damn-fuck-i-burnt-myself-again

[systlin]

I need this framed on my wall it’s so beautiful. 

[retro-minty]

@theshitpostcalligrapher

[theshitpostcalligrapher]

ay @systlin hmu

[bold-sartorial-statement]

@systlin

My husband complained that this was more Shakespeare than Eddas, and I challenged him to do better.

Solen sken, skönt gyllene

Dagen Tor föddes

På trottoaren, vid Taco Bell

Där låg Loke

—KJN

My translation:

The sun shone, sweet golden

The day of Tor’s birth

On the tarmac, by Taco Bell

There lay Loki

(For poetry reasons, Thor needs the Swedish spelling.)

[theshitpostcalligrapher]

@bold-sartorial-statement

ay yo show ur husband 

[andersonsallpurpose]

@bold-sartorial-statement no but hang on this should be in runes: 

(oops spot the typos)

[svampurinn]

i wanna translate this into icelandic so imma do it 

Sólin skein, björt og gullin við fæðingu Þórs á stígnum við Taco Bell Þar lá Loki

[books-and-candy-ples]

The amount of quality going into these shitposts is amazing

[rembrandtswife]

This is not shitposting, this is transformative work!

[deeranger]

And in Danish because why not:

Solen skinnede, skøn og gylden

På dagen for Tors fødsel

På asfalten ved Taco Bell

Dér lå Loke

“LEV MERE (LIVE MAS)”

*Snorts*

[marvel-lous-things]

When Thor born

He hair shine brite

A very very

Magical site

But then I see

A bab from hell

I pik up loki

From taco bell

[scarlet-silverweaver]

the rosetta stone of shitposting

[roguehoneybadger]

@incorrectnorse-quotes

[incorrectnorse-quotes]

Now THIS is the best post on this hellsite

[tentacion3099]

[angelofdykeness]

I FOUND IT THANK GOD this video is so important

[blue-eyes-white-cheddar]

This is real and here is the patent. Nonconsensual data collection is detailed in column #4 on page 17.

[paper-mario-wiki]

i fucking LOVE this dude (FLESH SIMULATOR is the name of his accounts). all of his videos are full of information and tips like this, and he always has loud industrial tone music mixed poorly over him speaking to make it impossible to create a clean AI copy of his voice.

[neosatsuma]

jury-rigged. even keel. by the board. three sheets to the wind. loose cannon. son of a gun. pipe down. taken aback.