hello mcrblr! :) ive been inspired by the emergence of emosystem blogs (@birdgee) lately and wanted to get in on the fun but unfortunately am very very bad at picking images- however i DO LIKE studying genetics. also heavily inspired by the iconic @hellsitegenetics, i will be transforming ur favorite bandom lyrics/interviews/posts into genetic sequences.
au c gg g u g g a a ga g a a C A a g a u u u a a a a u ag cau u au u a a c a a u a ca a a a u a u a a a u gg g a u a a g u a a g u c a c u u a a a a g a u
closest match: Berghia stephanieae, the aphid-eating nudibranch
image: Rola, M & Frankenbach, S et al. (2022). Cladobranchia (Gastropoda, Nudibranchia) as a Promising Model to Understand the Molecular Evolution of Photosymbiosis in Animals. Frontiers in Marine Science. 8. 10.3389/fmars.2021.745644.
asks are open! check here before sending :) (updated 4/17/2025)
consider helping me pay to finish my education!
banned from BLAST for being too sexy
trans supportive forever
check out the archive of every creature that has appeared! (archive maintained by @i-am-the-plagu3)
CREATURE WARNING:
this blog posts BEASTIES and ORGANISMS. if you are uncomfortable with seeing any manner of organism (spiders, rodents, fish, etc) please block the tags for that organism before following/browsing.
for broad categories: i tag in plurals (insects, bugs, spiders, fish, rodents, parasites, pathogens, plants, trees, worms, etc.)
for specific organisms: i tag in singulars (dobsonfly, eurasian harvest mouse, etc.)
for disease causing bacteria: i tag the illness it causes (malaria, botulism, etc.)
for additional phobias: i tag with the specific phobia ("tw trypophobia", etc.)
FOR FLASHING LIGHT SENSITIVE USERS: any gifs i post are tagged with "gifs," and any fast-moving or flashing gif/video will be tagged with "flashing".
FOR SCREENREADER USERS: by the nature of this blog, 99% of my posts will have large sections of unformatted letters, and therefore aren't very screenreader friendly. i apologize.
If I ever miss a tag or you'd like to request that I tag something, please send me a message.
FREQUENTLY ASKED QUESTIONS:
Are you a bot?:
no, just neurodivergent
How do you do this?:
i delete everything in a message except for the letters A, T, C, and G. then, i BLAST it with my powers.
Are you Italian?:
according to democracy, yes
How do I request things?:
read the REQUESTS section of this post :)
Why are there so many bugs???:
1. insects make up almost 80% of all animal life on earth
2. they are relatively easy to study, so there's more bug DNA in the BLAST database.
Okay but why so many MOTHS???:
because scientists are not immune to bias. moths are pretty looking and easy to study, so there is more moth DNA in the BLAST database.
Do the punctuation marks/emojis mean anything to BLAST?:
no, i just keep them there after my first pass of a text so you can easily recognize i'm using that same text to find an organism.
Can I send in general questions?:
yes! but they may get BLASTed.
Why are you marked red on shinigami eyes?:
i have no fucking idea dude. but if you want to check my blog for how i talk about trans folks, you're more than welcome to.
I'm checking your work, but I'm not getting the same results. Why?
im using nr/nt, the old database, rather than core_nt. this is probably why you're getting different results :)
REQUESTS:
to request something, please read this section and then send an ask.
asks that don't follow these guidelines will be deleted, and may get you blocked.
For questions: make sure it hasn't been already answered in the FAQ, then send.
For songs, poetry, bible verses, or otherwise long text (over 1500 characters, or text with a lot of spacing): send a link to the text or a pastebin with the text in it.
For Tumblr posts: send a link.
For other languages: make sure it's romanized (in latin script), then send.
REQUESTS I WILL NOT ANSWER:
things i have already answered. search the blog for whatever you're about to submit, and check the Frequently Requested section before sending.
private information (name, address, etc. YES people have tried this.)
AAAAAAAAAAA, GATCAGTCAGATTCCGACGGT, CATCATCATCAT, etc. get creative with it.
spam. (if i don't answer a request after a long time, feel free to send it again-- just not 5 times, please)
homestuck
FREQUENTLY REQUESTED:
The Bee Movie Script, navy seals copypasta, AM hate monologue, All Star, Yoshikage Kira, Never Gonna Give You Up, man door hand hook car door, Big Bill Hells, FNAF Connection Terminated, JURGEN LEITNER, Eggman's Announcement, Free Bird, Spiders Georg, Weed Smoking Girlfriends, Ebony Dark'ness Dementia Raven Way, Minos Prime, Steamed Hams, battery acid spaghetti, everyone get unemployed, squidward is nonbinary, What is a man?, fucking military wives, (this list will be updated as we go!)
thank you for reading! as a treat, enjoy this Lamprocapnos spectabilis, or Bleeding Heart flower.
au c gg g u g g a a ga g a a C A a g a u u u a a a a u ag cau u au u a a c a a u a ca a a a u a u a a a u gg g a u a a g u a a g u c a c u u a a a a g a u
closest match: Berghia stephanieae, the aphid-eating nudibranch
image: Rola, M & Frankenbach, S et al. (2022). Cladobranchia (Gastropoda, Nudibranchia) as a Promising Model to Understand the Molecular Evolution of Photosymbiosis in Animals. Frontiers in Marine Science. 8. 10.3389/fmars.2021.745644.
Bullets(?) Gerard is this Bumblebee bat (aka Kitti's hog-nosed bat) !
Bat Fact: "Kitti's hog-nosed bat occupies limestone caves along rivers within dryĀ evergreenĀ orĀ deciduousĀ forests.Ā In Thailand, it is restricted to a small region of theĀ Tenasserim HillsĀ inĀ Sai Yok District,Ā Kanchanaburi Province, within theĀ drainage basinĀ of theĀ Khwae Noi River." (Source)