#alittleballoonreplies

[rose-feathers]

2, 25, 27, 59, 68, 84, 99, 130, 171, 179, 184, 193, 195. I hope that's not too many! ^.^

This is just fine! Help’s me kill some time really.

195:My shoe size is: 9

193:My height is: 5′5″

184:Xbox or ps3: ps3

179:Spongebob can: twerk

171:Do you play an instrument? I can play the Cello!

130:Wal-Mart or Target: Walmart because it has fabric lol

99:Went to a movie theater: Yes! Recently to see fantastic four…no good ;-;

84:People call me: Kim

68:The worst sound in the world: the sound of scratching foil and the squeaky rail on the train ugh

59:The movie I cried at was: I don’t usually cry but A.I. artificial intelligence

27:Clothing store: Cotton On and Forever 21

25:TV show: Fresh off the boat

2:Dog breed: german shepard!

[rose-feathers]

I got to talk to a friend today and make sure she was doing okay. I got to see a groundhog today scurrying in the backyard and trying to blend in with the squirrels. A bunch of small things made it good.

Oh man that sounds great. and a ground hog trying to blend also sound hilarious! It’s the little things.

[rose-feathers]

Hey do you mind if i vent to you a little bit?

About me? Or if it’s other stuff I don’t mind. Go ahead. It’s better than keeping it bottled up. If youre on anon it will be posts publicly unfortunately.

[rose-feathers]

dbrittany: I need to watch this. Is it on Netflix?

It's not on netflix! It's tokyo ghoul and it might be better to read it than watch it since it diverges from it. Anime is still good though. 

[rose-feathers]

Lol, no, sorry. It was my copy pasta. The DNA thing was hilarious.

Pffffff I was wondering what it was! 

[rose-feathers]

not gonna lie. alot about this post makes me angry.

Which post? The DNA code thing?

[rose-feathers]

CTTCAGATAGATTATATCTGGAGTGAAGAATCCTGCCACCTATGTATCTGGCATAGTGTGAGTCCTCATAAATGCTTACTGGTTTGAAGGGCAACAAAATAGTGAACAGAGTGAAAATCCCCACTAAGATCCTGGGTCCAGAAAAAGATGGGAAACCTGTTTAGCTCACCCGTGAGCCCATAGTTAAAACTCTTTAGACAACAGGTTGTTTCCGTTTACAGAGAACAATAATATTGGGTGGTGAGCATCTGTGTGGGGGTTGGGGTGGGATAGGGGATACGGGGAGAGTGGAGAAAAAGGGGACACAGGGTTAATGTGAAGTCCAGGATCCCCCTCTACATTTAAAGTTGGTTTAAGTTGGCTTTAATTAATAGCAACTCTTAAGATAATCAGAATTTTCTTAACCTTTTAGCCTTACTGTTGAAAAGCCCTGTGATCTTGTACAAATCATTTGCTTCTTGGATAGTAATTTCTTTTACTAAAATGTGGGCTT

what the hell were you typing? DNA/RNA code?

[rose-feathers]

hey, do you know what the name of the gif of anime you just reblogged is called?

If it’s the one where the guy is being hit by a wooden pole then that would be Batman: Gotham Knight. I liked it a lot because of the different animation styles used for each of the stories. I would give it a look :)