#cranchiidae

[patheticmosasaur1]

today's invertebrate............bathothauma lyromma

bathothauma lyromma is always in shock and awe at the smallest things¡

if you ever learn about something cool or slimey please tell them because while they may have a thousand yard stare they are actually very joyful and (almost) always eager to see or hear new gloopy things!

in a way I think we should all be like bathothauma lyromma

glorpiness rating: 👀

source

in genuine awe of this creature

[every-day-creechur]

Cockatoo Squid Galiteuthis phyllura

A species of glass squid from the north Pacific, and possibly the second-largest squid by mantle length, up to 2.7m. It is possible that this squid has been observed from Remotely Operated Vehicles, on such occasions when startled it inflates its mantle and squirts ink into the mantle cavity.

Least Concern

image by MBARI

[dailycephalopods]

Daily Cephalopod #40

[snototter]

A cockatoo squid (Cranchiidae) swims through the depths along the Gulf of Alaska, USA

by NOAA Ocean Exploration

[nature-and-biodiversity-blog]

Banded Piglet Squid Helicocranchia pfefferi

[patheticmosasaur1]

every image of

sandalops melancholicus

that I could find*

also these 2 images I made

*there were also illustrations of individual body parts but I honestly have no idea what they are. I'm not a professional, just an enthusiast

also idk if this correct but I found the gene sequence of sandalops melancholicus from some page, though I mightve misread it or something like that don't take this as fact

TACATTATATTTTATCTTTGGTATCTGAGCAGGATTACTAGGAACCTCTTTAAGATTAATAATCCGTACTGAATTAGGACAACCAGGATCATTATTAAATGATGATCAACTTTATAATGTAGTTGTTACTGCCCATGGATTTATTATAATTTTCTTCTTGGTTATACCTATCATAATTGGGGGATTTGGAAATTGATTAGTACCTTTAATACTAGGAGCCCCAGATATAGCTTTTCCACGTATAAACAATATAAGATTCTGACTTCTTCCTCCATCTTTAACCTTATTACTAACCTCATCTGCTGTTGAAAGGGGGGCTGGTACAGGATGAACAGTCTATCCTCCCCTATCCAGTAATCTATCCCATGCAGGCCCTTCAGTGGATCTCGCCATTTTTTCTCTTCATCTAGCCGGAATCTCATCTATTTTAGGAGCAATTAATTTTATTACAACTATTTTAAATATACGATGAGAAGGTTTACAAATAGAACGTTTACCTTTATTTGCTTGATCAGTTTTTATTACAGCTATTTTACTCCTATTATCTTTACCAGTTTTAGCAGGGGCTATTACTATATTATTAACTGACCGGAATTTCAACACAACTTTCTTTGACCCTAGGGGGGGAGGAGACCCTATCTTATATCAGCACTTATTC

and this sandalops I drew at a whiteboard once

there are definitely more images out there, but I have no idea where to look

[patheticmosasaur1]

[patheticmosasaur1]

look what I found

the baby ♥