The Take-Home Message

A picture is worth a thousand words … so consider this a very long abstract.

[take-homemessage]

16. The Prius of the microbial world

All eukaryotic organisms have mitochondria…or do they? Mitochondria are the power sources that keep cells running; they have their own genomes and may have once been free living bacteria that formed a symbiotic partnership with the ancestors of eukaryotic cells. 

Until recently it was thought that all eukaryotic species possessed mitochondria. However, a study by Anna Karnkowska and colleagues, published in the journal Current Biology earlier this year, suggests that there may be an exception. The microbial species called Monocercomonoides does not seem to have mitochondria and may be the first known example of a eukaryote that lacks them.

For more information on this, have a look at this great NPR article about the subject.

[take-homemessage]

15. Awesome Animals: Episode I

We thought we would launch an occasional series of posts that looked at some of the impressive abilities of animals that you may not be aware of.

Consider the humble pigeon (Columba livia). Although many of us like to think of them as ‘flying rats’, they have a number of useful abilities. Chief among these is their ability to use magnetoreception find their way home over extremely long distances. Because of this, pigeons were used in both World Wars to deliver messages, with some being decorated with medals.

Perhaps more impressively, pigeons have also been shown to recognize familiar human faces and to be able to differentiate between humans. This 2011 research also revealed that pigeons remember people who have acted with hostility towards them and will try to avoid those people in the future.

As of this writing, it is unknown whether or not pigeons possess a sense of vengeance, but let’s just say that if you find your car being pooped on with some regularity, it might be personal.

[take-homemessage]

14. Cheetah vs Car vs Beetle

A recent story in New Scientist magazine looked at some new research regarding the speed of waterlily beetles (Galerucella nymphaeae) as they skim across the surface of water.

Using high-speed imaging, the researchers revealed the complex dynamics of how these beetles fly at the 'air-water interface' with their body weight being supported by the surface tension of the water.

The New Scientist article reveals that, scaled for size, these beetles travel at an impressive speed…equivalent to a human travelling around 500 kph (310 mph)!

[take-homemessage]

13. If Body Size = Genome Size

Some species of amoeba, such as the wonderfully named Chaos chaos, have estimated genome sizes of over one trillion bp (our puny human genomes are only a mere 3 billion bp or so)! These estimates may merit caution however.

Genome sizes are normally based on the haploid nuclear content (also known as the C-value), but some genome estimates may have been based on the levels of total cellular DNA, which may include mitochondrial DNA. Also some amoeboe may be polyploid which would have greatly inflated the estimates of genome size.

Even if the estimates are off by an order of magnitude, ameobas would still have impressively large genomes. A complete amoeba genome sequence would justifiably merit a front-page splash in a prestigious journal. If you are interested in the topic of genome size you are encouraged to check out this great FAQ from the Animal Genome Size Database.

[take-homemessage]

12. The loneliest mammal

Homo sapiens are the only extant species in the genus Homo. However, when we ascend the taxonomic tree to reach the broader classification of family, we are joined by six other great ape species (family Hominidae).

Continuing up the taxonomic tree, we reach the rank of order in which humans are joined by over 450 other Primate species ranging in size from the tiny mouse lemur to the mighty eastern gorilla.

So if we were to hold a taxonomic-based ‘family reunion’, or even an 'order reunion’, we would find ourselves in plenty of good company. Other species, however, are not so fortunate.

As an example of a monotypic taxon, the aardvark (Orycteropus afer) finds itself with no other living species in either the same genus, family (Orycteropodidae), or order (Tubulidentata). This may make the aardvark one of the loneliest mammals on the planet…taxonomically speaking of course.

[take-homemessage]

11. TCACCCATCGATGAACGAATGGCCAAT

A recent publication by Labonte et al. in the journal PNAS looked at the anatomical challenges faced by animals that can climb smooth, vertical walls.

Specifically, the researchers investigated over 200 species to study the relationship between body size and the amount of adhesive pads needed to be able to climb.

The authors conclude that geckos may represent the largest size that a climbing animal can attain:

We show that to support a human’s body weight, an unrealistic 40% of the body surface would have to be covered with adhesive pads,

The practical implications of this work relate to interests in developing synthetic adhesives inspired by biology.

If you are interested in learning more, we encourage you to take a look at the associated University of Cambridge news story:

Why Spider-Man can’t exist: Geckos are ‘size limit’ for sticking to walls

On the other hand, eyeball-licking has no known physical size limitations and makes for a good party trick.

[take-homemessage]

10. Adventures in Sequencing: Episode I

This is the first post in a new series which we will return to from time to time. We thought that occasionally we would take a break from current developments in molecular biology and instead look back at milestones in the history of DNA sequencing…

In 1967, Raymond Wu and Armin Kaiser published details of the 5’ nucleotide from the overhanging ends of several phages (a phage is a virus that infects a bacterium). A year later they went on to publish details of 10 nt from the ends of bacteriophage λ ; by their estimations this represented half of the (overhanging) sequence. Figure 7 from this paper may represent one of the first ever attempts to represent a DNA molecule as a sequence of A, C, G, and T characters (most sequencing attempts prior to this had focused on RNA molecules).

The painstaking work to complete the sequence continued and Wu published an update in 1970 which revealed that the lengths of the overhanging ends may be only be 12 nt, not 20 as previously thought:

The estimation of the length of the cohesive ends of λ DNA using incorporation data may still be in error by 10 to 15%. The exact length will not be known until the nucleotide sequence of the cohesive ends is completely established.

Wu did not have to wait too long to determine the complete sequence. A year later he published another paper, this time with collaborator Ellen Taylor:

Nucleotide sequence analysis of DNA. II. Complete nucleotide sequence of the cohesive ends of bacteriophage lambda DNA.

The introduction to this paper remarked:

In this communication, we wish to report on the complete sequence of deoxynucleotides in the two cohesive ends of a molecule of λ DNA. The sequence which is 12 base pairs in length consists of ten G-C and two A-T pairs. The procedures described here for sequence determination utilizing DNA polymerase-catalyzed incorporation may also be applicable to sequence analysis in other types of DNA molecules.

It would take another 11 years before the full 48,502 bp DNA genome sequence of bacteriophage λ would be determined. The lead author on that particular publication is someone who will probably feature in their very own episode of Adventures in Sequencing!

[take-homemessage]

9. GCCCTTCCCCATGCCGACGAAACC

With remarkable foresight, it was back in 1972 that the International Union of Pure and Applied Chemistry (IUPAC) assigned official single letter abbreviations for amino acids. The idea was actually proposed by IUPAC four years earlier…and may have been suggested by others as far back as 1958! The 1972 proposal noted:

Various difficulties are encountered when presenting the formulas of long protein sequences in the usual three letter symbols. Space is often at a premium. A one-letter code minimizes this difficulty and has other distinct advantages.

In addition to providing letters for the 20 proteinogenic amino acids, IUPAC also assigned additional letters to represent two closely related pairs of amino acids: asparagine (N) or aspartic acid (D) could be represented by B, and glutamine (Q) or glutamic acid (E) could be represented by Z. Additionally, a 23rd letter (X) was used to represent unknown amino acids.

This arrangement served the world pretty well until research showed that two of the three signatures that normally mark the point where DNA should no longer be translated into protein — the so called stop codons — are sometimes used to code for rare amino acids instead. Thus we had the discoveries of Selenocysteine in 1986 and Pyrrolysine as recently as 2002. IUPAC reacted by assigning these amino acids the letters U and O respectively.

This only leaves the letter J unaccounted for. Although IUPAC has not officially sanctioned its use, they have noted that J is sometimes used in NMR work to represent the amino acids isoleucine (I) or leucine (L). This means that if a 23rd amino acid is discovered, there are no remaining letters in the (Roman) alphabet that can be assigned to it. Though there are still many other characters on your keyboard…

[take-homemessage]

8. CCCATCGGC

BGI, the genomics powerhouse based in Shenzhen, recently announced that they will be selling genetically engineered miniature pigs as pets. For $1,600 (US) you could become the owner of a 'micropig', which reach weights of only ~15 kg (~33 lb).

The pigs were originally bred for research purposes; the scientists involved used a popular gene editing approach based on enzymes called TALENs (Transcription Activator-Like Effector Nucleases). The TALENs were used to knock-out a copy of the pig's growth hormone receptor gene (GHR), resulting in the pint-sized porcines.

We at the Take-Home Message were naturally curious about the future of this micropig technology! If you would like to know more about this story check out this great Nature News item.

[take-homemessage]

7. TGTTCTATT

The surprising evidence that humans can differ in the bacteria that surround us, and that these differences can be enough to identify someone, comes from a recent paper by Meadow et al. published in the journal PeerJ. By using a sanitized, and climate controlled, experimental chamber, the authors could closely monitor (and identify) the airborne bacteria that surrounded different test subjects. They also identified microbes from bacterial particles that can settle.

They found that occupants of the chamber could be reliably identified by either their microbial emissions or by the settled particles, concluding that that individual humans release a ‘personalized microbial cloud’.

The authors suggest possible forensic applications that could arise from these findings, e.g. being able to detect whether someone has been in an area based on their unique microbial profile. As such, we at The Take-Home Message welcome our new (but actually ancient) microbial overlords.

[take-homemessage]

6. AGCACGATATGCAAGTAC

A recent paper by Michael Todhunter et al., published in the journal Nature Methods describes a technique called DNA-programmed assembly of cells (DPAC). Cells that are coated in short DNA molecules can be made to stick to other cells that are coated in complementary DNA sequences. Repeated cycles of this ‘velcro’ approach can be used to build up cellular tissue that has a three dimensional structure.

Although direct applications of this technology — for fields such as regenerative medicine or tissue engineering — are still far away, this method may help researchers better understand how the collective behavior of cells can lead to tissue formation.

We also encourage readers to check out the great Ars Technica article relating to this paper.

[take-homemessage]

5. ACTTGGGAAAATACTTAT

On the 28th July in 1995, a breakthrough achievement was published in the journal Science with the description of the first ever genome sequence of a free-living organism. The organism in question was the bacterium Haemophilus influenze, and it took only 85 days before the number of published bacterial genomes doubled with the addition of the Mycoplasma genitalium genome.

In the decade that followed, the number of completed bacterial genome sequences doubled almost every year. The ability to decipher the genomes of bacteria (and archaea) has since become so straightforward (and relatively inexpensive), that it is no longer easy to keep track of just how many genomes have been sequenced (and sequencing a genome no longer guarantees a prestiguous publication).

As of September 2015, the Ensembl Bacteria website describes 23,002 genomes, whereas the Genomes OnLine Database (GOLD) catalogs 42,817 genomes. If you also include fragmented genome assemblies (consisting of contigs as well as scaffolds and complete chromosomes), then the NCBI's 'Genome List' details 47,350 bacterial genome sequences.

[take-homemessage]

#4. TCTTGGGCTCCT

Baker’s yeast (Saccharomyces cerevisiae) is a unicellular fungi that is widely used as a model system for studying biology. In 1996, it became the first eukaryotic species to have its genome sequenced, revealing a genetic blueprint that is approximately 250 times smaller than that of humans.

Even though yeast contains far fewer genes than we do (maybe ~30% as many), there are still several thousand genes that are conserved between yeast and human — even though the two species are separated by almost a billion years of evolution.

This makes a recent discovery by Kachroo et al. particularly surprising. Published in the journal Science the authors revealed that a large number of genes from yeast can be replaced with their human equivalents and still remain functional.

The yeast genes that they chose to replace are all essential for yeast to survive in standard laboratory conditions and all have identified orthologs in human. Amazingly, just under half of the the 414 yeast genes that were replaced with human equivalents remained functional.

But surely someone out there will want to try it in the opposite direction…

Budding bonus: all the BUDdy puns you could make with your new friend/daughter/clone.

[take-homemessage]

#3. CTCGAGAACGGAACACAC

In 2006 the world of DNA sequencing was transformed by a company called Solexa introducing the ‘Genome Analyzer’ sequencer. This marked a huge transition from the established Sanger sequencing technology that had been used to sequence the majority of published genomes at that point.

The read lengths produced by the first Genome Analyzer machines were very short, approximately 25 bp. In contrast, Sanger sequencing reads were typically 750–1,000 bp. However, the much reduced length of Solexa reads was offset by the much higher output and lower cost of the technology.

Solexa was swiftly acquired by Illumina and continued technological improvements have led to increases in read length and throughput. Illumina’s popular HiSeq 2500 machines can now produce reads up to 250 bp — an order of magnitude longer than where they started out — and the MiSeq platform goes further still, with read lengths up to 300 bp.

While read lengths produced by Illumina machines are slowly approaching those of the Sanger-sequencing era, other platforms have generated even longer reads. The RS II machine launched by Pacific Biosciences in 2013, produces reads with average lengths of 10–15,000 bp (with some reads exceeding 40,000 bp). Even longer reads have been produced by Oxford Nanopore’s MinION sequencer, with some approaching 100,000 bp (although average read length more closely resemble that of PacBio’s RS II).

Clearly, ever increasing read lengths are an inevitable part of how DNA sequencing technology will evolve…

The new Revolocity system by Complete Genomics does indeed produce reads of just 28 bp! Short is the new long.

P.S. For a visual overview of how the read length and throughput of various sequencing platforms have changed over time, see this great post by Lex Nederbragt: Developments in high throughput sequencing.

[take-homemessage]

2. AACGAGAGTACAGAGGAC

Aphids are an interesting species for biologists to study because, like certain other species, they can undergo parthenogenesis, i.e. they can reproduce without sex. What makes aphids doubly fascinating is that they also exhibit a phenomenon that has been described as telescoping of generations. This means that the a female aphid will have her daughter (a clone) growing inside her, with the grand-daughter aphid growing inside the daughter! Kind of like a real-life set of Russian Dolls.

If you are interested in learning more, have a look at at this 2002 review paper for Trends in Ecology and Evolution (Ecology and evolution of sex in aphids) or read this great post from Simon Leather’s Don’t Forget the Roundabouts blog: Living inside your grandmother – the wonderful world of aphids.

Shh, don’t tell the father. Oh, wait…

[take-homemessage]

1. GATGCTCCTCCTGAACGC

The Tuxedo suite is the name used to refer to a collection of popular bioinformatics tools designed to perform various tasks with high-throughput sequencing data. Developed by different people, there is no single website for these tools (though there is a Google Discussion Group for Tuxedo Tools Users). Here is a list of the current Tuxedo tools:

Bowtie and Bowtie 2 align sequencing reads to long reference sequences

TopHat is a fast splice junction mapper for RNA-Seq reads

Cufflinks assembles transcripts, estimates their abundances, and tests for differential expression and regulation in RNA-Seq samples

CummeRbund is an R package that is designed to aid and simplify the task of analyzing Cufflinks output

Monocle is a toolkit for analyzing single-cell gene expression experiments

Jaunty Feather may be of particular use for students who wish to improve their aligned read counts without asking their professors to fund more sequencing.

Update 2015-07-15: It turns out that there is already a bioinformatics tool called Spats!