“i was half a virgin when i met him!!”

Chloe | 21 | I just yell in the tags a lot //

[hem1ock]

Visit Original Link

sometimes i feel ive got to *minecraft death sound* *minecraft death sound* run away

[spelldealer]

[thepurplebones]

Super Bowl Half Time Show:

[buggyness101]

I was so excited and then let down.

[blizzardphobe]

i speak french in public to my grandparents and to my boyfriend. people are surprised that im bilingual and say its cool and ask me to teach them some time

but when one of my classmates speaks arabic in public to her family, she gets strange and disgusted looks. no one asks to be taught arabic. no one says its cool that shes bilingual

its racism plain and simple

[debaucherries]

Finding out Bo Burnham is 6'5" and not like 5'11" has absolutely killed me today. The concept of some Goliath twink pacing around a stage yelling absurdities and throwing glitter is triggering my fight or flight response

[distac-deactivated20240729]

I’m sorry HE’S WHAT NOW??

[theshitpostcalligrapher]

req’d by @katfuzz

this is fuckin pacifist route erasure bud

[katfuzz]

I senta humble prayer to a god and they responded, holy shit

[theshitpostcalligrapher]

i am just,,, a humble togetherslapper of words,,, not meant to be deified,,,

[dliessmgg]

Too late, you are now The Oracle.

[theshitpostcalligrapher]

>:(

i dont wanna be the oracle

[the-mountains-shadow]

Is this because of your aversion to being the main character?

[theshitpostcalligrapher]

maybe

[soyamorsoyvida-deactivated20191]

op is socrates

[theshitpostcalligrapher]

D:<

[i-hate-chick-fil-a]

this has to be the most disgusting thing i’ve ever seen

[madeupmonkeyshit]

when someone is physically attractive but boring as hell

[ridleey]

movies : Ponyo On The Cliff By The Sea - Gake no Ue no Ponyo (崖の上のポニョ) | 2008

“I love Ponyo whether she’s a fish, a human, or something in between.”

[lifesanemotionalrollercoaster]

Me to myself every time I try to socialize with new people:

[goldnpoc]

[unclefather]

Cher destroying gender

[tokoshi-deactivated20191031]

my 2019 resolution is to live deliciously

[mwg-drwg]

Incase anything happens to my account here’s my entire genome:

GATTTACTCGTACGGTACGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGYTTCCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATTAOCGGTACGATCCCGTAGGGTAGGGGGTTAATTGGCTCTGAGGGTTCTYCTCAATCCTCAATCAATCCTCHUATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGAATTCCAATCAATCCTCAATCATCAATCAACTCKAATCAATCCTCHATCTNACCCCCTTTAFCOGATCCCGTAGGGTAGGATCCTCATCTACCCTTCCTTTAFCGATCCCGTAGWGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTGATTTACTCGTACGGTACGATCCCGTAGGGTAGGGGGTTAAGGCTCTGIAGGGTTCCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGHCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATTACGGTACGATCCCGTAGGGTAGGGGGTTAATTGGCTCTGAGGGTTCTYCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCACGTAGGGTAGGGGGTTAAGGCTCTGAGGGAATTCCAATCAATCCTCAATCATCAATCAACTDCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCATCTACCCTTCCTTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTCATCTACCCCCTTTAFCGATOCCCGTAGGGTAGHGCCTCAATCATCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCHATCTACCCCCTTTAFCGATCCCGDTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCATCTACCCCCTTTAFOCGATCCCGTAGGGTAGHGCCTCAATCATCAATCCTCAATCCTTTAFCGATCCCGTAGGGTIAGGATCCTCATCTACCTCTTCCTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAOATCCTCTCAATCCTCAATCAATCCTCATCTACCCCCTTTAFCGATCCCGTAGGGTAGHGCCTCAATCATCAATCCETCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCATCTACCCCCTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTMTCCAATCAATCCTCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGG…

[monkeysky]

You got like six unique nucleotides so nice

[deepspacepirate]

OP is a virus from outer space

[deepspacepirate]

FUCK YOU OP

[locate-lucky-luciano]

Lucky is evolving past his image form

[khemicalvex]

[twitterlols]

[theshittyfoodblog]

Wine glass full of Mac and cheese garnished with two dinosaur chicken nuggets.

[sandandglass]