The Bright Sessions
PR's Tumblrdome
blake kathryn
Cosmic Funnies
untitled
Cosimo Galluzzi
almost home
🪼
noise dept.
shark vs the universe
RMH
art blog(derogatory)
EXPECTATIONS
ellievsbear
Cookie Run:Kingdom Official!
Phantogram Three
hello vonnie
No title available
Show & Tell
PUT YOUR BEARD IN MY MOUTH
seen from Singapore
seen from Bangladesh
seen from United States
seen from Brazil
seen from United States
seen from Singapore
seen from United States
seen from United States
seen from Singapore
seen from China
seen from United States
seen from Germany
seen from United States
seen from United States
seen from United States
seen from United States
seen from Bangladesh
seen from Italy
seen from Haiti
seen from United States
@cyanidesymphoniesxylophones
For new people hello i am Cyanide Symphonies Xylophone or Casks for short. I write about plants, space orcs and fantasy stuff.
The Casks nickname is purely intentional. You can call me Casket if you want to be funny.
You can use any pronouns to refer to me, but I prefer being called Casks. Or any of the three words in my username.
Posts that stay in the drafts for being too good
do the draft post know they in there ? in there in the drafts
Posts that stay in the drafts for being too good
do the draft post know they in there ? in there in the drafts
For the love of god stop
this post seems to have broken containment and if anyone's interested in what they were telling me to stop, i found the og post with this song and was mass reblogging it at an alarming rate. ive done this multiple times but i think this was the instance i reblogged it 64 times in a row
For the love of god stop
this post seems to have broken containment and if anyone's interested in what they were telling me to stop, i found the og post with this song and was mass reblogging it at an alarming rate. ive done this multiple times but i think this was the instance i reblogged it 64 times in a row
Just so you all know, my tumblr glitched egregiously so now every time someone reblogs this from me, tumblr takes me off of my dashboard or search results and forces me to see this post again
WHY DID SOMEONE ADD AN INCINERATOR ????
I STILL HAVE TO SEE THIS BTW. ITS BEEN YEARS.
And you will see it again.
And again
lowkey she might be the only thing keeping these guys like. powered.
*through gritted teeth* the world is GOOD. people are kind. Humans are NOT inheritly selfish. you will make it through this year. recovery is possible. people you don't know yet will love you. You are going to do things you can't even imagine right now. You are going to read a rlly good book. You are going to eat some rlly good food. You are going to experience joy again. Things can get better. Situations can change. You can choose to be kinder. The world can change for the better.
Big and small henchmen for the villain in one of those secret-life-of-mice movies from the 80s
@rslashrats
I was about to go to sleep last night when something hit me.
Never had i ever been struck with inspiration so hard and so fast.
At least they got their priorities straight.
Bonus:
this scene
“hi welcome to mcdonalds what can i get for you?”
“yeah can i get a deluxe quarter pounder with cheese?”
“absolutely, do you want the meal or just the sandwich?’
“uuuuuh hold on”
*fishes something out of my pocket*
“mikey what do i do?”
“get the fries. youll need the energy in the coming days”
*stuffs it back in my pocket*
“uhh yes please the meal would be great”
String identified: ctcaatcagtacagtaattcatattattactgtctatgtttgtcgattacctatagat
Closest match: Udea ferrugalis genome assembly, chromosome: 11 Common name: Rusty Dot Pearl
(image source)
the world may be a dark place sometimes but there are also 1200 year old paw prints from a happy kitty cat out there
