👻

i'm just your average tumblr blogger. follow for average tumblr blogging. ¯\_(ツ)_/¯

[thesadghostclub]

I just want to leave everything behind for a day or two…

Shop / About Us / FAQ’s / comics / Archive / Subscribe / Theme

[supernatasha]

Lovers adorn and admire one another (Utsav 1984)

[desbianherstory]

“Utsav belongs to the genre of courtesan films that plays on the nostalgia for an ancient erotic Indian past. The narrative follows Vasantsena (played by Bollywood icon Rekha), a fourth-century prostitute, as she falls in love with a young Brahmin merchant named Charudutt. Halfway through the film, Charudutt is temporarily shunted out of the narrative by a growing friendship between Vasantsena and his wife Aditi. In a telling scene, Vasantsena and Aditi sing to each other after exchanging clothes and jewelry. This act of making oneself desirable, of dressing and undressing, donning and discarding saris and jewelry in particular, is a sexually loaded trope in popular Indian cinema, having connotations of wedding nights and signifying a prelude to heterosexual sex. Utsav reworks the typical love triangle of popular film where two women compete for the man’s attention; here, it is Charudutt who is sidelined while the two women play erotically together. Interestingly, some feminist analyses of the film have critiqued this scene as merely ‘‘playing out the ultimate male fantasy,’’ whereby female bonding between the wife and the courtesan enable the man to ‘‘move without guilt between a nurturing wife and a glamourous mistress.’’ Clearly such an interpretation misses the more nuanced eroticism between the two women that a queer reading makes apparent. A queer reading might also allow for the possibility of triangulated desire that does not solidify into ‘‘lesbian’’ or ‘‘heterosexual,’’ but rather opens up a third space where both hetero- and homoerotic relations coexist simultaneously. The relation between the two women also hints at the histories of female homoerotic relations that mark the space of the tawai’if (courtesan) household, as Veena Talwar Oldenburg’s ethnography of courtesans in 1970s Lucknow, North India, documents.”

—Gayatri Gopinath, Impossible Desires: Queer Diasporas and South Asian Public Cultures

[somebodytodiefor]

FUCK / SORRY

[sludgejudy-deactivated20170915]

the chocolates your total comes to onemilliononehundred HuUuh

yeaAah thats whatit saAays, that mustbe REALLYgood chocolate paperorplastic

uuweweuundeheuhme

[coratorium]

the digimon movie is really good

[gif87a-com]

[acreaturecalledgreed]

Orange Cat: [unfriendly/somewhat sharp meow]

Second cat slowly looks at the camera.

Man, filming, bashfully and sounding somewhat frightened: Sorry!

[ocfos]

I’ve never fuckin seen a cat move like that, and it feels so goddamn eerie.

[heavyweightheart]

Research has shown that pleasure affects nutrient absorption. In a 1970s study of Swedish and Thai women, it was found that when the Thai women were eating their own (preferred) cuisine, they absorbed about 50% more iron from the meal than they did from eating the unfamiliar Swedish food. And the same was true in the reverse for the Swedish women. When both groups were split internally and one group given a paste made from the exact same meal and the other was given the meal itself, those eating the paste absorbed 70% less iron than those eating the food in its normal state.

Pleasure affects our metabolic pathways; it’s a facet of the complex gut-brain connection. If you’re eating foods you don’t like because you think it’s healthy, it’s not actually doing your body much good (it’s also unsustainable, we’re pleasure-seeking creatures). Eat food you enjoy, it’s a win-win.

[jenroses]

what

no seriously

what?

[effielovesapples]

freddied krueger: welcome to your nightm

me:*remembers this is MY dream and i can do WHATEVER i want!!!!!!!!!!!*

[therebewhaleshere]

New Bechdel-like test for gay/lesbian romance films:

Your gay characters cannot:

Have an illegal or otherwise creepy age gap.

Cheat on each other or anyone else (especially not if the cheating is portrayed as romantic).

Die tragically, violently or AT ALL. 

[strongorcbutch-deactivated20220]

To all the people in the notes going “but but tragedy is a valid form of…” Yeah, sorry, straights broke it with decades of nothing but tragedy for LGBT characters. This is a moratorium on all such tragedy films with tragic endings for at least the next 50-75 years at which point there will be a review to determine if mainstream media has EARNED it. 

[lynati]

my brain, interrupting my daydream: this is poorly researched and the narrative is not compelling

[norcumi]

Brain: “Do it again, take it from the top.”

[moveslikekeithrichards]

when u stand w ur hands Like That

rebolg if u agree

[kidouyuuto-deactivated20140411]

how did they learn to translate languages into other languages how did they know which words meant what HOW DID TH

[brigwife-deactivated20240426]

English Person: *Points at an apple* Apple

French Person: Non c’est une fucking pomme 

*800 years of war*

[agentverbivore]

Fun fact: There are a lot of rivers in the UK named “avon” because the Romans arrived and asked the Celts what the rivers were called. The Celts answered “avon.” 

“Avon” is just the Celtic word for river.

[thejazzykittykat]

Fan Fact #2: When Spanish conquistadors landed in the Yucatán peninsula, they asked the natives what their land was called and they responded “Yucatán”. In 2015, it was discovered that in those mesoamerican languages, “Yucatán” meant “I don’t understand what you are saying”

[xyxul-deactivated20201020]

W H E E Z E

[snoopygrover]

I see no difference

[gayerthenthefourthofjuly]

Thirteen adding more and more rainbows to her outfit

[mwg-drwg]

Incase anything happens to my account here’s my entire genome:

GATTTACTCGTACGGTACGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGYTTCCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATTAOCGGTACGATCCCGTAGGGTAGGGGGTTAATTGGCTCTGAGGGTTCTYCTCAATCCTCAATCAATCCTCHUATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGAATTCCAATCAATCCTCAATCATCAATCAACTCKAATCAATCCTCHATCTNACCCCCTTTAFCOGATCCCGTAGGGTAGGATCCTCATCTACCCTTCCTTTAFCGATCCCGTAGWGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTGATTTACTCGTACGGTACGATCCCGTAGGGTAGGGGGTTAAGGCTCTGIAGGGTTCCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGHCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATTACGGTACGATCCCGTAGGGTAGGGGGTTAATTGGCTCTGAGGGTTCTYCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCACGTAGGGTAGGGGGTTAAGGCTCTGAGGGAATTCCAATCAATCCTCAATCATCAATCAACTDCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCATCTACCCTTCCTTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTCATCTACCCCCTTTAFCGATOCCCGTAGGGTAGHGCCTCAATCATCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCHATCTACCCCCTTTAFCGATCCCGDTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCATCTACCCCCTTTAFOCGATCCCGTAGGGTAGHGCCTCAATCATCAATCCTCAATCCTTTAFCGATCCCGTAGGGTIAGGATCCTCATCTACCTCTTCCTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAOATCCTCTCAATCCTCAATCAATCCTCATCTACCCCCTTTAFCGATCCCGTAGGGTAGHGCCTCAATCATCAATCCETCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCATCTACCCCCTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTMTCCAATCAATCCTCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGG…

[crypticdatesuggestions]

Date the one who shows up when you call their name on the evening breeze, who comes to sweep you away to a gas station and will chew gum and sit on the curb next to you as you close your eyes and imagine the flourescent stars.

Date the one who seems to live with you in those calm in-betweens, driving through the neighborhood at 7pm on the way back from the grocery store when you are too tired to turn on the radio and they are there to make sure you get home safe.

Date the one who understands the wanderlust and chooses to stay by your side, even sometimes offering you one of their crushed granola bars as your shadows mix on the sidewalk illuminated by streetlights. You will take care of each other.

[thewhimsyturtle]

[depeshemode]