Pretty Little Mason Jar

Olivia | she/her | A crusty 22 y/o | PrettyBi

[yesterdaysprint]

Judge magazine, 1921

[princelapine-deactivated2025031]

this has been a mood for nearly 100 years now

[butchmachine]

One more year before the 100year anniversary

[kitkatsmol]

it’s been 100 years now

[yellovv]

happy centennial anniversary to a meme about looking shitty in photos 🥳 🍾

[npr]

Back in the 1960s, the U.S. started vaccinating kids for measles. As expected, children stopped getting measles.

But something else happened.

Childhood deaths from all infectious diseases plummeted. Even deaths from diseases like pneumonia and diarrhea were cut by half.

“So it’s really been a mystery — why do children stop dying at such high rates from all these different infections following introduction of the measles vaccine,” says Michael Mina, a postdoc in biology at Princeton University and a medical student at Emory University.

Scientists Crack A 50-Year-Old Mystery About The Measles Vaccine Photo credit: Photofusion/UIG via Getty Images

[jessicalprice]

Using computer models, they found that the number of measles cases in these countries predicted the number of deaths from other infections two to three years later.

“We found measles predisposes children to all other infectious diseases for up to a few years,” Mina says.

And the virus seems to do it in a sneaky way.

Like many viruses, measles is known to suppress the immune system for a few weeks after an infection. But previous studies in monkeys have suggested that measles takes this suppression to a whole new level: It erases immune protection to other diseases, Mina says.

VACCINATE. YOUR. DAMN. KIDS. 

[thevastnessof]

a rlly good trope is a teenager who was forced to grow up too fast suddenly being surrounded by teens who love having fun and goofing off, and just slowly starting to come out of their shell and do dumb stuff just for the hell of it bc they can finally act their age

[eternalgirlscout]

#im thinking abt zuko and hnghgj #him and sokka are so funny #3 swords #2 teenage boys #1 brain cell

op why would you hide this vital content in the tags i’m

[cannibalchicken]

[toastbutteregg]

[arktham]

My name is Peter Parker. My universe is 1933, and I’m a private eye. I like to drink egg cream, and I fight Nazis. A lot.

Spider-Man: Into the Spider-Verse 2018, dir. Bob Persichetti & Peter Ramsey

[pseudophan]

ideal existence

[guyinabugway]

Imagine never being late to anything

[a-fools-stone]

“what time is it?” *gets arrested*

[papasmoke]

Please list your full genome sequence in your bio

[papasmoke]

Louis | 24 | Bi | They/Them | GATTACATACCTTACTTATTACCGATAGGGCAGATTACGGACCTATTAGATTACATAGATAGGGGAAAAAACATAGATACATACGTAGTTGCTCGACACTAGATTACAGATACTAATATTTTGATACCCAGGTTAGACGATTACAGATTACATTACAGGATACCGATGAGGATAGGACGATTACATACCTTACTTATTACCGATAGGGCAGATTACGGACCTATTAGATTACATAGATAGGGGAAAAAACATAGATACATACGTAGATTACATTAGACCATAGGTTGCTCGACACTAGATTACAGATACTAATATTTTGATACCCAGGTTAGACGATTACAGATTACATTACAGGATACCGATGAGGATAGGA | White

[papasmoke]

People are telling me that this genome sequence is "too short" and "doesn't match any known organism" and if my genome looked like that i would be "dead" but maybe those people simply haven't optimized their genomes like I have

[grimeclown]

[officialqueer]

This photo of my brother's cat trying to jump on the dinner table at Christmas feels like a Normal Rockwell painting.

[officialqueer]

He just wants to be included!!

(He's got an Insta btw).

[krawdad]

[officialqueer]

This is so funny, please never spread it because my mother will kill me.

[theartofanimation]

Leslie Strock  -  https://nokkiart.tumblr.com  -  https://www.lesliestrock.com  -  https://www.instagram.com/nokki1  -  https://www.linkedin.com/in/leslie-strock-6b76a43a  -  https://www.patreon.com/lesliestrock  -  https://twitter.com/nokkinatter?lang=es  -  http://www.gallerynucleus.com/artist/leslie_strock  -  http://ctnanimationexpo.com/leslie-strock  -  https://www.etsy.com/market/leslie_strock  -  https://inkphy.com/user/nokki1/179479188

[theartofanimation]

Heather Penn  -  http://happydorid.tumblr.com  -  https://twitter.com/heatpenn  -  https://www.kickstarter.com/projects/607081461/tea-spirits-2015-calendar  -  https://www.inprnt.com/gallery/happydorid  -  https://dribbble.com/fastbee  -  https://www.instagram.com/heatpenn

[tiktoksthataregood-ish]

[xetl]

[threebigolsausages-deactivated2]

okay, who tf put this monolith in my toilet?

[theonion]

[auliicravalhogifs]

Was there one [Princess] in particular that you were excited to meet?