Musicophilia

Elena • 23 • Bay Area trash

[botanyshitposts]

scientists in the 1990s, putting a Get More Purple gene attached to a harmless plant virus into an already purple petunia: please get more purple

the petunia, sensing an apparent honest to god Get More Purple Disease, using the previously undiscovered RNAi antiviral ability to shut down all other purple genes along with it just in case: you put VIRUS in petunia? you infect her with the More Purple?? oh! oh! her children shall bloom white! jail for mother, jail for mother for One Thousand Years!!!!

[flipocrite]

[clickityweasel]

[engiqueers]

shout out to the little monk in each of my cells that transcribes my DNA by candle light

[alisonzai]

[duncan-tashi]

BLACK WOMEN in Fantasy films.

[ahagisborn]

was just Remembering how you’d be out with a friend and you’d each order a different cocktail and you’d ask “what’d you get?” and they’d read the description off the menu and you’d be like “ooh that sounds good” and then they’d say “try it!” and then you’d have a lil sip of their drink and they’d have a lil sip of your drink and you’d decide which one was best and you wouldn’t give each other a life-threatening respiratory infection

[briannabakerarchive]

RINA SAWAYAMA behind the scenes of the Rolling Stone photoshoot (March 2021)

[voulair]

Chloe x Halle for Garage Magazine by Daria Kobayashi Ritch 

[my-kind-of-love1]

[scenics]

RINA SAWAYAMA XS (LIVE)

[tiktoksthataregood-ish]

[deadbyinsidee]

[africugh]

Disney channel original movie and chill

[papasmoke]

Please list your full genome sequence in your bio

[papasmoke]

Louis | 24 | Bi | They/Them | GATTACATACCTTACTTATTACCGATAGGGCAGATTACGGACCTATTAGATTACATAGATAGGGGAAAAAACATAGATACATACGTAGTTGCTCGACACTAGATTACAGATACTAATATTTTGATACCCAGGTTAGACGATTACAGATTACATTACAGGATACCGATGAGGATAGGACGATTACATACCTTACTTATTACCGATAGGGCAGATTACGGACCTATTAGATTACATAGATAGGGGAAAAAACATAGATACATACGTAGATTACATTAGACCATAGGTTGCTCGACACTAGATTACAGATACTAATATTTTGATACCCAGGTTAGACGATTACAGATTACATTACAGGATACCGATGAGGATAGGA | White

[papasmoke]

People are telling me that this genome sequence is "too short" and "doesn't match any known organism" and if my genome looked like that i would be "dead" but maybe those people simply haven't optimized their genomes like I have

[mens-rights-activia]

[scenics]

Chloe x Halle Are Just Getting Started

[valtsv]

girl i can torment you with incomprehensible horrors

[schaduwen-deactivated20220817]

made a more accurate hierarchy of (my) needs