this shit sucks. wish bulbasaur was real .
sheepfilms
2025 on Tumblr: Trends That Defined the Year

@theartofmadeline
ojovivo

shark vs the universe
AnasAbdin
Cosmic Funnies
Aqua Utopia|海の底で記憶を紡ぐ
taylor price

Product Placement

#extradirty

⁂
Jules of Nature
KIROKAZE

oozey mess
cherry valley forever
tumblr dot com
Xuebing Du
Peter Solarz

pixel skylines
seen from Sweden
seen from United States

seen from Germany
seen from T1

seen from Netherlands
seen from United States
seen from Honduras
seen from Bangladesh
seen from Sweden
seen from Australia

seen from United States

seen from Malaysia
seen from Italy

seen from United States
seen from United States
seen from United Kingdom
seen from United States
seen from United States

seen from Germany

seen from Malaysia
@nicdaclowny
this shit sucks. wish bulbasaur was real .
i love deleting things . its like. bye. lol
Resident Evil 4 » Leon Kennedy
the sexy girlbots are returning. nature is healing
It's like when they reintroduced wolves to yellowstone
YOU CALL THIS HEALING?!? I'M UNDER FUCKING SIEGE
- deer and other prey animals when they reintroduced wolves to Yellowstone
my blorbo appears on screen and I start making clicking-chattering noises like a cat when a bird flies past the window
guy that says grace before giving head
who wanna come over and clap when bad things happen in horror movies with me
oh you mean with hands
not ruling anything out
are you still okay with us calling you king, dude and other masc terms or should we just use neutral terms?
I really dont mind bein called anything lmao its all good
Okay boy repellent, love u 🫶🏻
not that.
Larval stage
I love showing people a picture of my cat for the first time and they go "aww" and then I say "her name is Pigeon" and they go "aww her name is PIGEON" bc this knowledge has made her cuter
this is Pigeon btw
pov: ur a mosquito or perhaps a spider
Please list your full genome sequence in your bio
Louis | 24 | Bi | They/Them | GATTACATACCTTACTTATTACCGATAGGGCAGATTACGGACCTATTAGATTACATAGATAGGGGAAAAAACATAGATACATACGTAGTTGCTCGACACTAGATTACAGATACTAATATTTTGATACCCAGGTTAGACGATTACAGATTACATTACAGGATACCGATGAGGATAGGACGATTACATACCTTACTTATTACCGATAGGGCAGATTACGGACCTATTAGATTACATAGATAGGGGAAAAAACATAGATACATACGTAGATTACATTAGACCATAGGTTGCTCGACACTAGATTACAGATACTAATATTTTGATACCCAGGTTAGACGATTACAGATTACATTACAGGATACCGATGAGGATAGGA | White
People are telling me that this genome sequence is "too short" and "doesn't match any known organism" and if my genome looked like that i would be "dead" but maybe those people simply haven't optimized their genomes like I have
Feeling Ethereal 👑
cant believe i’ve never shared arguably the funniest dms i’ve ever gotten in my life