this shit sucks. wish bulbasaur was real .
No title available
Jules of Nature
Sweet Seals For You, Always
todays bird

izzy's playlists!
Xuebing Du
official daine visual archive

@theartofmadeline
No title available
No title available
Cosmic Funnies

No title available

No title available
Doug Jones
Noah Kahan

gracie abrams

bliss lane

if i look back, i am lost

blake kathryn

No title available

seen from Malaysia
seen from United Kingdom

seen from Saudi Arabia

seen from Colombia
seen from Argentina

seen from Singapore

seen from Russia
seen from South Korea
seen from Singapore

seen from Italy
seen from United States
seen from Brazil
seen from Brazil
seen from United States

seen from United States
seen from United States

seen from Malaysia
seen from Colombia
seen from Brazil

seen from Malaysia
@nicdaclowny
this shit sucks. wish bulbasaur was real .
i love deleting things . its like. bye. lol
Resident Evil 4 » Leon Kennedy
the sexy girlbots are returning. nature is healing
It's like when they reintroduced wolves to yellowstone
YOU CALL THIS HEALING?!? I'M UNDER FUCKING SIEGE
- deer and other prey animals when they reintroduced wolves to Yellowstone
my blorbo appears on screen and I start making clicking-chattering noises like a cat when a bird flies past the window
guy that says grace before giving head
who wanna come over and clap when bad things happen in horror movies with me
oh you mean with hands
not ruling anything out
are you still okay with us calling you king, dude and other masc terms or should we just use neutral terms?
I really dont mind bein called anything lmao its all good
Okay boy repellent, love u 🫶🏻
not that.
Larval stage
I love showing people a picture of my cat for the first time and they go "aww" and then I say "her name is Pigeon" and they go "aww her name is PIGEON" bc this knowledge has made her cuter
this is Pigeon btw
pov: ur a mosquito or perhaps a spider
Please list your full genome sequence in your bio
Louis | 24 | Bi | They/Them | GATTACATACCTTACTTATTACCGATAGGGCAGATTACGGACCTATTAGATTACATAGATAGGGGAAAAAACATAGATACATACGTAGTTGCTCGACACTAGATTACAGATACTAATATTTTGATACCCAGGTTAGACGATTACAGATTACATTACAGGATACCGATGAGGATAGGACGATTACATACCTTACTTATTACCGATAGGGCAGATTACGGACCTATTAGATTACATAGATAGGGGAAAAAACATAGATACATACGTAGATTACATTAGACCATAGGTTGCTCGACACTAGATTACAGATACTAATATTTTGATACCCAGGTTAGACGATTACAGATTACATTACAGGATACCGATGAGGATAGGA | White
People are telling me that this genome sequence is "too short" and "doesn't match any known organism" and if my genome looked like that i would be "dead" but maybe those people simply haven't optimized their genomes like I have
Feeling Ethereal 👑
cant believe i’ve never shared arguably the funniest dms i’ve ever gotten in my life