RNA Framework

[rnaframework]

RNA Framework v2.7.0 released

This new version solves a potentially severe (although very rare) bug and introduces a new tool:

- Transcript IDs containing a slashes (”/”) are now handled by automatically converting slash characters to underscores (”_”). Many thanks to Dr. Artem Babaian for reporting this issue.

- After some work, we are proud to finally introduce the first version of rf-mutate. This tool has the unique ability to design mutations aimed at disrupting target structure motifs, and/or compensatory mutations aimed at rescuing the wild-type structure. Noticeably, this is (to our knowledge) the only tool that allows designing RNA structure mutants by preserving the underlying amino acid sequence (in case of motifs falling within ORFs).

We originally created this tool to disrupt target motifs within Influenza A virus (IAV) mRNAs (PMID: 31053845), by preserving the encoded protein sequence and avoiding the introduction of rare codons.

rf-mutate needs:

One or more structure files (dot-bracket or CT format)

A motif file (containing the list of target motifs to disrupt, mandatory)

An ORF file (containing details on whether and where an ORF resides within the target transcripts, optional)

If an ORF file is not provided, rf-mutate is also able to automatically identify the longest ORF.

In the following example (the relevant dot-bracket file can be retrieved from here), we show how rf-mutate works on a key motif we have previously identified in segment 4 (HA) of IAV. This motif is located between positions 1606-1669 of the HA mRNA. In the motif file must be indicated either the start coordinate of the motif (the first base-paired residue of the opening helix), or the dot-bracket representation of the motif itself (then rf-mutate will automatically identify the coordinates of the motif):

 HA_4;1606  or  HA_4;(((((((.........((((((((..........))))))))...............)))))))

As this is a protein-coding transcript, rf-mutate needs to be instructed on where does the ORF start. This can be done by either providing an ORF file, or by letting rf-mutate automatically look for the longest ORF. If an ORF file is provided, this can either contain the start-end coordinates of the ORF, or the amino acid sequence. In the latter case, both the full sequence or only a portion of it can be provided. rf-mutate will then automatically extend it up to the closest in-frame STOP codon (both upstream and downstream):

 HA_4;32-1732  or  HA_4;32  or  HA_4;IYSTVASS

Given a number of mutations to operate, rf-mutate will try to different combinations of synonymous codons (or bases in the case of non-coding regions), evaluating the resulting mutants based on the base-pair distance between the mutant and wild-type structures and on the free energy difference between the two structures. Designed mutant/rescue pairs are then ranked in such a way that the average probability of formation of the wild-type base-pairs is minimized in the mutant ensemble and maximized in the rescue ensemble. The result is an XML file (for each target motif):

 <?xml version="1.0" encoding="UTF-8"?>   <motif energy="-24.30" frame="9-74" id="seg4" position="11-74">   <result n="0">     <mutant codons="6,20" ddG="8.40" distance="51" energy="-15.90" probability="0.00">       <sequence>AUGGGGAUCUAUCAGAUUCUCGCGAUCUAC       UCAACUGUCGCCAGUUCACUGGUGCUUUUGGUUUCC       </sequence>       <structure>..((((((((...)))))))).........((((....((((((....))))))...)))).....</structure>     </mutant>     <rescue codons="2,14" ddG="8.90" distance="6" energy="-15.40" probability="0.81">       <sequence>AUGGGGACCUAUCAGAUUCUCGCGAUCUAC       UCAACUGUCGCCUCUUCACUGGUGCUUUUGGUUUCC       </sequence>       <structure>..(((((((((((((......(((((..........))))).......)))))).....)))))))</structure>     </rescue>   </result>  </motif>

For additional details, please refer to the documentation.

[rnaframework]

RNA Framework v2.6.9 (major) released

It has been a while since the last RNA Framework version has been released. This new version bundles together several changes (for the complete list, please refer to the changelog). Particularly:

- The rf-correlate tool has been added to calculate pairwise correlations of structure probing experiments

- The rf-combine tool now allows combining only transcripts whose correlations between multiple replicates exceed a given threshold

- When using a gene annotation for which the gene symbol is available, rf-index will now build by default a reference using only the longest representative isoform for each gene

- The rf-peakcall tool now allows refining peak boundaries (please refer to the documentation). Furthermore, it can now report a BED file containing peak summits, and plots of coverage per transcript (as well as transcriptome-wide meta-gene plots).

The above example has been generated using N1-methyladenosine data from m1A-seq in MEF (Dominissini et al., 2016; PMID: 26863196).

For more information, please refer to the documentation.

[rnaframework]

RNA Framework v2.6.7 (minor) released

This release fixes an unexpected behavior in rf-fold causing pseudoknots to not being reported under specific circumstances.

Moreover, this release introduces a new feature in the rf-norm tool. Now, sliding-window normalization can be performed using dynamic windows. This feature is particularly useful when analyzing RNA probing experiments performed using base-specific reagents (e.g. DMS, CMCT, Kethoxal, etc.).

Using dynamic windows, the size of the normalization window is dynamically adjusted to include the required number of reactive bases (e.g. A/C residues for DMS-modified RNA molecules, as in the above example). This allows minimizing overestimation artifacts caused by the uneven distribution of reactive bases along the analyzed transcript.

For more information, please refer to the documentation.

[rnaframework]

RNA Framework v2.6.6 (minor) released

This release fixes a bug in rf-fold causing the software to get stuck when trying to generate graphical reports for transcripts with only 0/NaN reactivity values (thanks to Dr. Uciel Pablo Chorostecki for reporting this bug).

Moreover, this version introduces a new feature in the rf-count utility. Now, it is possible to specify transcript regions that must be excluded from RT-stops/mutations/coverage counting. This feature is particularly useful when dealing with targeted mutational profiling-based (MaP) structure probing experiments (see below).

In the above example, targeted SHAPE-MaP analysis of a long transcript has been performed by using 9 tiling primer pairs. PCR products from either odd primer pairs or even primer pairs have been pooled ans sequenced independently, then mapped to the reference transcript. At this stage, rf-count can be used to count the number of mutation events per base. A mask file, containing either the sequence or the 1-based coordinates of the primer annealing regions, is provided along with the analyzed BAM file. The two generated RC files generated can be then combined using the merge tool of the rf-rctools utility. The resulting merged RC file can be then normalized by the rf-norm software, yielding the final reactivity profile for the full transcript.

For additional details, please refer to the documentation.

[rnaframework]

RNA Framework v2.6.5 (minor) released

This release adds the rf-rctools tool to allow easy manipulation/visualization of RC files.

Check it out on GitHub!

[rnaframework]

RNA Framework v2.6.1 (minor) released

This release fixes a couple of bugs causing folding to fail under windowed mode with window sizes < 50nt or pseudoknotted structures.

Check it out on GitHub!

[rnaframework]

RNA Framework published on NAR

We are happy to announce that our work on RNA Framework has been published on Nucleic Acids Research.

Check it out: https://t.co/GqHHIP2lkt

[rnaframework]

RNA Framework v2.6 released

This release fixes a few minor bugs, and adds several useful features for the analysis of mutational profiling (MaP) experiments:

- Added support for gzipped FastQ files to rf-map (thanks to Dr. Omar Wagih for feature request, and beta testing) - Introduced rf-map support for quality-based trimming of reads - Introduced new rf-count parameters to enable quality filtering of reads/mappings - Introduced rf-count support for insertions in SHAPE-MaP experiments - Introduced rf-count support for the re-alignment of ambiguously aligned deletions in SHAPE-MaP experiments - Added sampling of Zuker suboptimal structures to rf-fold pseudoknots detection algorithm (increases the searched folding space, and gives more accurate results)

Overall, this version adds several new parameters to rf-count, thus enabling a more accurate handling of mutation/indel events. It appears immediately clear that different parameter combinations produce very different outcomes. Here follows a brief scheme aimed at illustrating the different behaviors with different parameter combinations (dots correspond to sites of assigned mutations):

For additional details please refer to the documentation. Check it out on GitHub!

[rnaframework]

RNA Framework v2.5.4 released

This release fixes some bugs in multi-threading support, and introduces a new feature. Now, RF Compare automatically generates SVG graphics for each compared reference vs. predicted structure pair:

Check it out on GitHub!

[rnaframework]

RNA Framework v2.5.2 released

This release fixes some critical bugs, and introduces a new feature. Now, RF Fold automatically generates SVG graphical summaries for each predicted structure (reactivity data, Shannon entropy, base-pairing probabilities and MEA structure):

So now, you will have your figures ready for publication in a few minutes, without any effort. Hope you'll enjoy it!

Check it out on GitHub!

[rnaframework]

RNA Framework v2.5.1 released

This release adds back support for the Siegfried et al., 2014 (PMID: 25028896) method for SHAPE-MaP normalization. Now the method can be used even in the absence of a denatured control sample.

For additional details please refer to the documentation.

[rnaframework]

RNA Framework v2.5 released

After several months of hard work, the RNA Framework v2.5 is finally here. Several major changes have been introduced:

1. RF Fold now supports the windowed folding of large RNA molecules through an approach based on the original method described by Siegfried et al., 2014 (PMID: 25028896). For additional details please refer to the documentation.

2. Libraries underwent a substantial rewrite to introduce pseudoknots support. Pseudoknotted structure are supported both from CT and dotbracket (Vienna) files. To enable the support of complex pseudoknotted RNA topologies, an expanded dotbracket alphabet has been introduced, based on the same standard used in Stockholm files. Let's consider the following sample structure:

The topology of this structure is too complex to be described using the standard dotbracket notation. Through the use of an expanded alphabet, the RNA Framework can now represent the previous structure as follows:

.....(((((....[[[.....{{{...<<<....AAA..))))).....]]].....}}}>>>.....aaa..

3. Introduced the RF JackKnife utility to perform jackknifing (grid search) of optimal slope/intercept folding parameters. For additional details please refer to the documentation.

4. Much more...

Check it out on GitHub!