Oh, THAT sketch blog @thatsketchblog - Tumblr Blog

A doodle before the year is out

14. Cheetah vs Car vs Beetle

A recent story in New Scientist magazine looked at some new research regarding the speed of waterlily beetles (Galerucella nymphaeae) as they skim across the surface of water.

Using high-speed imaging, the researchers revealed the complex dynamics of how these beetles fly at the ‘air-water interface’ with their body weight being supported by the surface tension of the water.

The New Scientist article reveals that, scaled for size, these beetles travel at an impressive speed…equivalent to a human travelling around 500 kph (310 mph)!

#science #biology #comics #cheetah #fast things

take-homemessage

13. If Body Size = Genome Size

Some species of amoeba, such as the wonderfully named Chaos chaos, have estimated genome sizes of over one trillion bp (our puny human genomes are only a mere 3 billion bp or so)! These estimates may merit caution however.

Genome sizes are normally based on the haploid nuclear content (also known as the C-value), but some genome estimates may have been based on the levels of total cellular DNA, which may include mitochondrial DNA. Also some amoeboe may be polyploid which would have greatly inflated the estimates of genome size.

Even if the estimates are off by an order of magnitude, ameobas would still have impressively large genomes. A complete amoeba genome sequence would justifiably merit a front-page splash in a prestigious journal. If you are interested in the topic of genome size you are encouraged to check out this great FAQ from the Animal Genome Size Database.

#science #biology #amoeba #pufferfish #mouse #genomes

take-homemessage

12. The loneliest mammal

Homo sapiens are the only extant species in the genus Homo. However, when we ascend the taxonomic tree to reach the broader classification of family, we are joined by other six other great ape species (family Hominidae).

Continuing up the taxonomic tree, we reach the rank of order in which humans are joined by over 450 other Primate species ranging in size from the tiny mouse lemur to the mighty eastern gorilla.

So if we were to hold a taxonomic-based ‘family reunion’, or even an 'order reunion’, we would find ourselves in plenty of good company. Other species, however, are not so fortunate.

As an example of a monotypic taxon, the aardvark (Orycteropus afer) finds itself with no other living species in either the same genus, family (Orycteropodidae), or order (Tubulidentata). This may make the aardvark one of the loneliest mammals on the planet…taxonomically speaking of course.

#aardvark #biology #science #comics

#ipad pro #procreate app #sketch

take-homemessage

11. TCACCCATCGATGAACGAATGGCCAAT

A recent publication by Labonte et al. in the journal PNAS looked at the anatomical challenges faced by animals that can climb smooth, vertical walls.

Specifically, the researchers investigated over 200 species to study the relationship between body size and the amount of adhesive pads needed to be able to climb.

The authors conclude that geckos may represent the largest size that a climbing animal can attain:

We show that to support a human’s body weight, an unrealistic 40% of the body surface would have to be covered with adhesive pads,

The practical implications of this work relate to interests in developing synthetic adhesives inspired by biology.

If you are interested in learning more, we encourage you to take a look at the associated University of Cambridge news story:

Why Spider-Man can’t exist: Geckos are ‘size limit’ for sticking to walls

On the other hand, eyeball-licking has no known physical size limitations and makes for a good party trick.

#science #geckos #biology

Another practice

#furcadia #furcadia portrait #pixel art

Rosenheim portrait! Just to say I made something before the year was out.

#furcadia #furcadia portrait #pixel art #portrait

Practice, reference by zemotion

#sketch #zemotion #woman #portrait #practice #procreate

Playing around with Procreate (dat name doe)

#tyrande #heroes of the storm #night elf #warcraft #World of Warcraft #procreate

take-homemessage

9. GCCCTTCCCCATGCCGACGAAACC

With remarkable foresight, it was back in 1972 that the International Union of Pure and Applied Chemistry (IUPAC) assigned official single letter abbreviations for amino acids. The idea was actually proposed by IUPAC four years earlier…and may have been suggested by others as far back as 1958! The 1972 proposal noted:

Various difficulties are encountered when presenting the formulas of long protein sequences in the usual three letter symbols. Space is often at a premium. A one-letter code minimizes this difficulty and has other distinct advantages.

In addition to providing letters for the 20 proteinogenic amino acids, IUPAC also assigned additional letters to represent two closely related pairs of amino acids: asparagine (N) or aspartic acid (D) could be represented by B, and glutamine (Q) or glutamic acid (E) could be represented by Z. Additionally, a 23rd letter (X) was used to represent unknown amino acids.

This arrangement served the world pretty well until research showed that two of the three signatures that normally mark the point where DNA should no longer be translated into protein — the so called stop codons — are sometimes used to code for rare amino acids instead. Thus we had the discoveries of Selenocysteine in 1986 and Pyrrolysine as recently as 2011. IUPAC reacted by assigning these amino acids the letters U and O respectively.

This only leaves the letter J unaccounted for. Although IUPAC has not officially sanctioned its use, they have noted that J is sometimes used in NMR work to represent the amino acids isoleucine (I) or leucine (L). This means that if a 23rd amino acid is discovered, there are no remaining letters in the (Roman) alphabet that can be assigned to it. Though there are still many other characters on your keyboard…

take-homemessage

8. CCCATCGGC

BGI, the genomics powerhouse based in Shenzhen, recently announced that they will be selling genetically engineered miniature pigs as pets. For $1,600 (US) you could become the owner of a ‘micropig’, which reach weights of only ~15 kg (~33 lb).

The pigs were originally bred for research purposes; the scientists involved used a popular gene editing approach based on enzymes called TALENs (Transcription Activator-Like Effector Nucleases). The TALENs were used to knock-out a copy of the pig’s growth hormone receptor gene (GHR), resulting in the pint-sized porcines.

We at the Take-Home Message were naturally curious about the future of this micropig technology! If you would like to know more about this story check out this great Nature News item.