AAAAAAAAAAAAAAAAAAAAA

i don't know i just got here

[noorshukrisblog]

My name is Nour, I’m 18 years old. I once dreamed of becoming a doctor—to help people, to heal, to bring hope. I studied hard and believed that education was my way out😭.

But the war took everything.💔

In a single moment, my home was destroyed. Everything I loved—my books, my memories, my dreams—was buried under rubble.😭😭💔💔

Now, I live with my family in a torn tent. It doesn’t protect us from the cold or the burning heat. We have no food, no clean water, no safety—nothing.😭😭💔💔

Every night we sleep not knowing what tomorrow will bring: a chance at life… or more pain.🍉🍉

My mother is elderly and needs care. I used to dream of helping others, but today I can’t even help my own family.💔🍉

I’m reaching out to every kind heart reading this: please, help us. Any amount, any support, means the world.🙏🙏💔🍉

Your kindness could help us survive… and maybe, one day, I’ll return to school and chase my dream again.❤️

link gofandme

Donate to Help Nour's Family in their Time of Need, organized by Clara Marino

Hello, my friend Nour need's your help, now to survive war, displacement, and fa… Clara Marino needs your support for Help Nour's Family in

To donate or contact: [Insert your donation link or contact info here

Be our voice in a world that’s forgotten us. Be the light in our darkness.❤️

[angelgesic]

Anthy sketch I did after freshly finishing utena in 2024. If I knew how to read and write kannada or Tamil I would have written it in that because Anthy is Very Kannadigan or Tamilian to me. Unfortunately I can only write in hindi

[expressions-of-nature]

Kerala, India by Eshak Angell

[neopets-hentai]

PSA FOR ALL FLORDIANS!!! GET INSIDE NOW!!! Theres a category 3 milf heading STRAIGHT for Palm Springs!!!!

[sloppystyle]

[hellsitegenetics]

String identified: A A A!!! GT !!! T a catg ag TAGT a g!!!!

Closest match: Nemesignis banyulensis genome assembly, chromosome: 11 Common name: Orange Godiva

(image source)

[hellsitegenetics]

happy women’s day to her

[hazard-symbols-that-fuck-hard]

are mad-scientist-themed drag kings a common thing because i feel like they should be

because being a mad scientist just feels like drag to me. like, it’s inherently over-the-top camp.

[hazard-symbols-that-fuck-hard]

I can see it now. Lightning, glowing coils, a big giant switch… The curtain draws with an evil laugh, revealing…

…a baking soda volcano

[nyancrimew]

[hellsitegenetics]

String identified: aa a: ATGCGATATGCGCGATGCGATAGCGACAC, t gg a a tt a

Closest match: Agonopterix yeatiana genome assembly, chromosome: 15 Common name: Coastal Buff

(image source)

[slygirlboy]

customer service lego lady is kinda bad 🤤

[slygirlboy]

hold on a sec guys phone call

[slygirlboy]

they are putting me down

[hellsitegenetics]

String identified: ct c g a a a 🤤 a c g ca t a ttg

Closest match: Lepisma saccharinum genome assembly, chromosome: 8 Common name: Silverfish

(image source)

[freshlypickedmint]

rice, like humans, is mostly water. thus, eating rice may be essentially equivalent to cannibalism. and as we know, cannibalism is frequently used as a metaphor or even stand-in for gay sex. therefore eating rice can be seen as the same as gay sex. in this essay I will

[freshlypickedmint]

I have faith

[hellsitegenetics]

String identified: c, a, t at. t, atg c a ta at t caa. a a , caa t a a ta ta- ga . t atg c ca a t a a ga . t a

Closest match: Equus caballus genome assembly, chromosome: 19 Common name: Horse

(image source)

[everybidenjusthavegoodtime]

i finally found the best youtube comment

[hellsitegenetics]

String identified: !!! at a gat g t t ’ a t ’ ac a t t t ct

Closest match: Equus caballus genome assembly, chromosome: 9 Common name: Horse

(image source)

[lupineshieldmaiden]

zygaenidae pngs𓂃 ࣪˖ ִֶָ𐀔

send requests .ᐟ.ᐟ જ⁀➴ ✉

[karlmarxmaybe]

IMPORTANT!! FUNDS NEEDED TODAY TO SAVE A BABY!!

Go to paypal.me/ofkt637 and type in the amount. Since it’s PayPal, it's easy and secure. Don’t have a PayPal account? No worries.

I'm sorry I need to ask people for help. I'm crying. I don't know what to do. Raneen and Ahmed, @a00h3, are my friends. They live in Gaza. Their baby Mohammed has cancer; we urgently need $900 before the end of the week to pay for his life-saving surgeries. Please donate to help the baby live!!

Their account is vetted by @90-ghost , @gazavetters (#576) , and @bilal-salah0. Gofundme takes too long, you can dm @a00h3 if you want to confirm that paypal goes to them. Please help.

When you donate, please don't mention Raneen or Ahmed Hammad in the paypal message. PayPal is racially profiling and it is retaining all money that accompanies those names. PLEASE HELP MY FRIENDS SURVIVE THIS INJUSTICE!!

[familyranda]

Guys share my story don't skip ‼️

My friends, please look at these unbearable prices — they're beyond what any struggling family can afford. Most of us can't even dream of buying all these basic items. But with just $10, you can help me get even one essential thing — and believe me, that small amount could save a whole oppressed family from hunger and despair. Please, let your kindness reach us.😪🍉🇵🇸🫂

[feeblyweepingworm]

[feeblyweepingworm]

‼️URGENT‼️

salama has a new câmpaign‼️ Now he has access to full d0nations

He is in urgent need of €500 to buy a flour bag‼️

Be the first dønor👇

Verified✅📻🍉

https://www.paypal.me/SALAMAABULEHIA

https://gofund.me/b353f5ef

[onenicebugperday]

Vivid dancer, Argia vivida, Coenagrionidae, Zygoptera

Found in western North America

Photos 1-2 by Thomas Shahan, 3 by leslie_s, and 4 by camerondeckert

[anas-fromgaza]

⚠️‼️PLEASE DO NOT IGNORE⚠️‼️

We have collected $15,337 raised of $20,000 !🇵🇸

🇵🇸 save family lost their home ,dreams and everything in Gaza 🇵🇸

This is my home before the war and after the war how it became💔💔💔

Before: After:

We have been through many wars before, but this war was not like the ones before it. Our lives were turned upside down. We became displaced from one place to another. We are the Anas family, residents of northern Gaza, specifically in the Shujaiya area. In the first week of the war, we fled our home because everyone considered our home to be in a dangerous area. We moved to the Rimal area, specifically in the middle of Gaza. There, we received the news that our home, which contained all our beautiful memories, was bombed. Suddenly, it was gone!!! Just thinking that your home, which you worked hard on and built from scratch and took a lot of your life, was gone in less than a second ! After a while, we left the sands to the Al-Zawaida area because of the heavy shelling. We stayed there for about two weeks, and then the terrorist army asked us to go to Rafah. We actually fled for the fourth time to Rafah and stayed there for two months, some of the most difficult days of our lives, as there was no way or means to live a normal life. 😔😔 After that, because of the invasion of Rafah, we moved to Deir al-Balah. Now, we are in very difficult and oppressive circumstances.

We are asking you with all shame to support and stand by us in these difficult circumstances that everyone knows because we lost our home, our work and any stable source of income. Thank you all.

🔗 🔗 Gofundme link for donations 👇👇👇👇🔗 🔗

Donate to Help Anas family in Gaza ,Save us from war and bombing, organized by Moaz MUHAISEN

Hello everyone, We are the Anas family, consisting of 5 m… Moaz MUHAISEN needs your support for Help Anas family in Gaza ,Save us fr

Please, we are in dire need of you and your support. If you cannot donate, you can share☹️❤️🥹

Even $5 will make a big difference and save us!

Verified by : @nabulsi

To my followers, this is a legitimate fundraiser. Donate if you can! And please share! I'll write a more detailed post soon ♥ 🙏 Hello We a

[t00thpasteface]

cell bio professor closed out today's lecture on free-radical oxidation in mitochondria and programmed cell death by saying "you've probably all seen those commercials for fruit juice that says it's got antioxidants, which are said to prevent this sort of thing from happening, or at least slow it down. well, they don't work. this is an inevitable fact of life— this process that lets us live is also the thing that kills us, and it's why all of us will die someday. there's no escaping that. it's been with us since the dawn of eukaryotic cells; our pact with mitochondria is to the death. anyway, enjoy the rest of your friday, and remember, exam four is next week!"

[hellsitegenetics]

String identified: c c t ta' ct -aca at tca a ga c at ag "' a a t cca t c tat a t' gt atat, c a a t t t t tg ag, at at t . , t 't . t a ta act — t c tat t a t tg tat , a t' a a. t' cag tat. t' t c t a atc c; act t tca t t at. aa, t t a, a , a t !"

Closest match: Lythrum hyssopifolia genome assembly, chromosome: 4 Common name: Hyssop Loosestrife

(image source)

[hellsitegenetics]