Tiny Viking

Lise - 21 - Norwegian lesbian | She/Her | I like dogs

[switchbladesounds-deactivated20]

dude where’s my

ability to experience pleasure in the things that give me a reason to live

[introsquirrel]

County roads

Full of holes

On the route

I need to go

Road construction

Lane obstruction

Let me go

County roads

[physics-dirtbag]

Me every single night:

[gluom]

im always DTF

(Dealing with Thoughts of Failure)

[that-house]

Frat boy vampire draining someone while his bros chant “CHUG CHUG CHUG” in the background

[bitchassslytherinsnakery]

Mutuals this could be us

[addyincolor]

Opening up a boy with the cold ones

[papasmoke]

Please list your full genome sequence in your bio

[papasmoke]

Louis | 24 | Bi | They/Them | GATTACATACCTTACTTATTACCGATAGGGCAGATTACGGACCTATTAGATTACATAGATAGGGGAAAAAACATAGATACATACGTAGTTGCTCGACACTAGATTACAGATACTAATATTTTGATACCCAGGTTAGACGATTACAGATTACATTACAGGATACCGATGAGGATAGGACGATTACATACCTTACTTATTACCGATAGGGCAGATTACGGACCTATTAGATTACATAGATAGGGGAAAAAACATAGATACATACGTAGATTACATTAGACCATAGGTTGCTCGACACTAGATTACAGATACTAATATTTTGATACCCAGGTTAGACGATTACAGATTACATTACAGGATACCGATGAGGATAGGA | White

[papasmoke]

People are telling me that this genome sequence is "too short" and "doesn't match any known organism" and if my genome looked like that i would be "dead" but maybe those people simply haven't optimized their genomes like I have

[amourtality]

never understood the whole showing up at your high school reunion revenge fantasy cause like really? high school?? I don’t want anyone from that time in my life to have any idea where I am or what I’m doing. do not perceive me I am dead to you and you are dead to me

[mauriacs]

mr darcy lived in derbyshire so he sounds like. lizzeh. ah lov yew moost ahhdentleh

[quasarkisses]

wait the places in pride and prejudice are real?

[metapianycist]

england is indeed real

[kipplekipple]

Crying

[cosmog]

fucked up if true </3

[funny-tik-toks]

[alylovesfilms]

[socialcasualtxy]

[moviebee]

[she-volution-deactivated2022052]

[bmblb-fanatic]

It checks out

[sunshine-tattoo]

early 00s media was the era of the boring girl protagonist and her heavily lesbian-coded bff

[erzebett]

[finitetwilight]

You have been warned

[oh-my-fancan]

i was wondering what was wrong with this picture.... then I realized there was no blue filter

[finitetwilight]

can't believe I forget the tint™

[illbeintheattic]

the signs were everywhere

[bakwaaas]

is anyone else like....... exhausted? just way too tired? mentally and physically? and you look at other people your age who seem to be doing fine and you feel so dysfunctional and broken because normal adult tasks and responsibilities just feel way too overwhelming and you can’t cope and

[bohibohi]

logging on to post fanart logging right back off

(she doesnt like to sit on the subway seats)

[sliferslime-remade]

hey icarus bro wanna order some hot wings-oh my god im so fucking sorry dude

[butchyena]

ive been doing a lot of youtube recipe binging lately so i was recommended this video and i was like fuck it diet soup why not

and it sounded pretty tasty so after the vid i scrolled down to see what people thought of it, and i just really need to share with you all what the comment section is like

and for the one that broke me:

[joedizzlefoshizzel]

[honestmagpie]

I laughed so hard I gave myself an actual headache oml

[dnd-apothecary]

i laughed so hard at this comment

[tikkety-tok]

POV: Ethel brings you a leaf

[official-lucifers-child]

do you know how thrilled i was to realise this has audio and the audio is gorgeous???

[nuev0]

#beingacomputerprogrammingmajor : Testing out html scripts on Pokemon Go and finding out it actually works.

[morphimus]

Isn’t this a potential problem though? Can you run a malicious script in the namebox there? If so, they will most certainly have to fix that before they implement trading.

[nickelbackmidisonline-deactivat]

is it even possible to write a malicious script in html?

[timujina]

<hack>i’m in</hack>