dude where’s my
ability to experience pleasure in the things that give me a reason to live

No title available
dirt enthusiast
Alisa U Zemlji Chuda
Monterey Bay Aquarium

shark vs the universe
TVSTRANGERTHINGS
No title available
RMH

Kiana Khansmith
2025 on Tumblr: Trends That Defined the Year
d e v o n
Peter Solarz
I'd rather be in outer space 🛸

pixel skylines
tumblr dot com
Cosmic Funnies
Today's Document

@theartofmadeline
One Nice Bug Per Day
AnasAbdin
seen from Türkiye
seen from Sweden
seen from United States
seen from Morocco

seen from T1
seen from United States

seen from United States
seen from United States

seen from United Kingdom
seen from France

seen from United States

seen from Malaysia
seen from United States
seen from United States

seen from Morocco

seen from Spain
seen from Japan

seen from United States
seen from Morocco
seen from Germany
@somerandomwirdo
dude where’s my
ability to experience pleasure in the things that give me a reason to live
County roads
Full of holes
On the route
I need to go
Road construction
Lane obstruction
Let me go
County roads
Me every single night:
im always DTF
(Dealing with Thoughts of Failure)
Frat boy vampire draining someone while his bros chant “CHUG CHUG CHUG” in the background
Mutuals this could be us
Opening up a boy with the cold ones
Please list your full genome sequence in your bio
Louis | 24 | Bi | They/Them | GATTACATACCTTACTTATTACCGATAGGGCAGATTACGGACCTATTAGATTACATAGATAGGGGAAAAAACATAGATACATACGTAGTTGCTCGACACTAGATTACAGATACTAATATTTTGATACCCAGGTTAGACGATTACAGATTACATTACAGGATACCGATGAGGATAGGACGATTACATACCTTACTTATTACCGATAGGGCAGATTACGGACCTATTAGATTACATAGATAGGGGAAAAAACATAGATACATACGTAGATTACATTAGACCATAGGTTGCTCGACACTAGATTACAGATACTAATATTTTGATACCCAGGTTAGACGATTACAGATTACATTACAGGATACCGATGAGGATAGGA | White
People are telling me that this genome sequence is "too short" and "doesn't match any known organism" and if my genome looked like that i would be "dead" but maybe those people simply haven't optimized their genomes like I have
never understood the whole showing up at your high school reunion revenge fantasy cause like really? high school?? I don’t want anyone from that time in my life to have any idea where I am or what I’m doing. do not perceive me I am dead to you and you are dead to me
mr darcy lived in derbyshire so he sounds like. lizzeh. ah lov yew moost ahhdentleh
wait the places in pride and prejudice are real?
england is indeed real
Crying
fucked up if true </3
It checks out
early 00s media was the era of the boring girl protagonist and her heavily lesbian-coded bff
You have been warned
i was wondering what was wrong with this picture.... then I realized there was no blue filter
can't believe I forget the tint™
the signs were everywhere
is anyone else like....... exhausted? just way too tired? mentally and physically? and you look at other people your age who seem to be doing fine and you feel so dysfunctional and broken because normal adult tasks and responsibilities just feel way too overwhelming and you can’t cope and
logging on to post fanart logging right back off
(she doesnt like to sit on the subway seats)
hey icarus bro wanna order some hot wings-oh my god im so fucking sorry dude
ive been doing a lot of youtube recipe binging lately so i was recommended this video and i was like fuck it diet soup why not
and it sounded pretty tasty so after the vid i scrolled down to see what people thought of it, and i just really need to share with you all what the comment section is like
and for the one that broke me:
I laughed so hard I gave myself an actual headache oml
i laughed so hard at this comment
POV: Ethel brings you a leaf
do you know how thrilled i was to realise this has audio and the audio is gorgeous???
#beingacomputerprogrammingmajor : Testing out html scripts on Pokemon Go and finding out it actually works.
Isn’t this a potential problem though? Can you run a malicious script in the namebox there? If so, they will most certainly have to fix that before they implement trading.
is it even possible to write a malicious script in html?
<hack>i’m in</hack>