Xuebing Du

blake kathryn

titsay
macklin celebrini has autism
ojovivo
cherry valley forever

@theartofmadeline
The Bowery Presents

No title available
No title available
Sade Olutola
official daine visual archive
Mike Driver

Origami Around

roma★
todays bird
2025 on Tumblr: Trends That Defined the Year
KIROKAZE
he wasn't even looking at me and he found me

ellievsbear
seen from Iraq

seen from United States
seen from Bangladesh

seen from India
seen from Brazil
seen from United States

seen from India
seen from Türkiye

seen from T1
seen from Malaysia

seen from Pakistan
seen from South Africa
seen from South Africa

seen from South Africa

seen from Germany
seen from South Africa

seen from India
seen from United States
seen from United States
seen from United States
@darkmagerat
omw to destroy the world
this was a fucking fatality
Little competition with Art prize!
https://discord.gg/QaHeFqJ
hehe gwuargh
Art trade with @grandestwisard
I had fun drawing their goat babe! #goatlove
art trade for @mousewaves !!! tyvm for the trade!! ♥️♥️♥️♥️♥️ her clown: Hex!
Not to alarm yall or anything but Brock FINALLY found himself a fucking queen
Black love all 2k19
Mob psycho is BACK ON MAAAAAAIN
me furby fursona (: draw him if u want
where the fuck can I get talons like these
uh oh
An extremely rare land snail from Borneo - Vitrinula sp.
These photos show a rare species of land snails of the genus Vitrinula, probably Vitrinula muluensis (Stylommatophora - Ariophantidae), found on the climb up Gunung Api to the Pinnacles overlook, in Gunung Mulu National Park, Sarawak, Borneo.
The most interesting feature of these snails is that the animal has two mantle-lobes as metallic-colored tendrils covering part of front of shell, which continually lick the shell. Those tendrils are in fact a double penis which exceed the periphery of the shell and are a diagnostic feature of the genus.
Little is known about this rarely seen species, which is not surprising considering that they have a very restricted habitat in the karst area of Gunung Mulu, since as Clements et al. (2008) indicate, limestone karsts on tropical land masses are considered de facto habitat islands due to their isolation from one another by non-calcareous substrata; this spatial configuration limits gene flow and induces high levels of species endemism.
Photo credit: [Top: ©ccdoh1 | Locality: Gunung Api, Sarawak, Borneo, Malaysia (2009)] - [Bottom: ©Alan Cressler | Locality: Gunung Api, Gunung Mulu National Park, Sarawak, Borneo, Malaysia (2009)]
References: [1] - [2]
snail dick so big it can't be contained
Incase anything happens to my account here’s my entire genome:
GATTTACTCGTACGGTACGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGYTTCCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATTAOCGGTACGATCCCGTAGGGTAGGGGGTTAATTGGCTCTGAGGGTTCTYCTCAATCCTCAATCAATCCTCHUATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGAATTCCAATCAATCCTCAATCATCAATCAACTCKAATCAATCCTCHATCTNACCCCCTTTAFCOGATCCCGTAGGGTAGGATCCTCATCTACCCTTCCTTTAFCGATCCCGTAGWGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTGATTTACTCGTACGGTACGATCCCGTAGGGTAGGGGGTTAAGGCTCTGIAGGGTTCCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGHCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATTACGGTACGATCCCGTAGGGTAGGGGGTTAATTGGCTCTGAGGGTTCTYCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCACGTAGGGTAGGGGGTTAAGGCTCTGAGGGAATTCCAATCAATCCTCAATCATCAATCAACTDCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCATCTACCCTTCCTTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTCATCTACCCCCTTTAFCGATOCCCGTAGGGTAGHGCCTCAATCATCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCHATCTACCCCCTTTAFCGATCCCGDTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCATCTACCCCCTTTAFOCGATCCCGTAGGGTAGHGCCTCAATCATCAATCCTCAATCCTTTAFCGATCCCGTAGGGTIAGGATCCTCATCTACCTCTTCCTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAOATCCTCTCAATCCTCAATCAATCCTCATCTACCCCCTTTAFCGATCCCGTAGGGTAGHGCCTCAATCATCAATCCETCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCATCTACCCCCTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTMTCCAATCAATCCTCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGG…
You got like six unique nucleotides so nice
OP is a virus from outer space
FUCK YOU OP
when tumblr gets inevitably deleted lets all go on one giant google doc
we would all have to… maybe….. each type with a unique color…………. or perhaps some other way of making our text entirely unique and recognizable
Something unique about our typing styles… Something perhaps that one might call ‘quirky’………
What does this mean?
god i wish i was you
8RING IT 8ACK NOW YALL
whats wrong with this girl
nothing