The woods are lovely, dark and deep...

Just a regular person. Sort of. There's some debate there. I'm a veterinarian (?!?!) as of May 2018, and doing an internship in exotic animal medicine. Ask questions if you have them. c:

[dappermouth]

Something in the wind has changed–it calls you by a different name.

[dirtmunch]

Hope my roommate likes this lol

[mezzodical]

one round/action in D&D is 6 seconds so anything you could accomplish during a vine you could do during your turn

[theorynoodle]

Rogue: “I’m back at it again at Krispy Kreme.”

DM: “Roll an acrobatics check.”

[lovelylovelyartist]

Fighter: I want to see my little boy

DM: roll a perception check

*nat 20*

DM: here he comes

[z-nogyrop]

bard: toss me my keys

*rolls a 1*

DM: i thought you said printer

[spiritednug]

Fairy: I still haven’t found my berries

DM: roll a perception check

*rolls a 9*

Fairy: BUT! *holds up an orange* I found this.

[bemusedlybespectacled]

Druid: I am the sand guardian, guardian of the sand.

DM: Roll an intimidation check.

*nat 20*

DM: Poseidon quivers before him!

Druid: Fuck off!

[redwoodriver-deactivated2018042]

Dm: can you read this for us?

Fighter: rolls a nat 1

Fighter: what up im Jared im 19 and I never fuckin learned how to read

[sparrow-va]

Fighter: It’s summer, I got my helm on backwards and it’s time to fuckin’ party.

DM: Roll for Dodge.

Fighter: *rolls a 1*

Fighter: *slams head into ye olde portcullis*

[rosentraume]

[livenarrator]

I can’t actually even process how bad this is. I logged of for the 17th and came back to find out 6 porn bots had followed me while I was logged out

[stimman3000]

jmdragunas

[catsbeaversandducks]

Wolfie the Werecat and his wonderful Enchanted Forest Kitty Sanctuary.

Photos by Wolfie

Cat Tree made by Hollywood Kitty Company

[millenniallust4death]

@molosseraptor

[molosseraptor]

It’s everywhere!

Everything about this is a dream come true.

[bob-belcher]

[alloverthegaf]

*slams back a bourbon whiskey* listen mate I’ve been here for all kinds of ridiculous tumblr meltdowns I was here when Yahoo took over I was here for dashcon I was here when the notes disappeared I was here back when those superwholock chain posts of fucking up non believers were taken seriously and through every single one I have done fuck all. I have not changed a goddang thing. I waited for the end and the end never came. I do not plan on changing my status quo now. either things will go on as they always have and in six months time I’ll be here watching staff announce that anyone with over 1000 followers are being monitored or I will have been physically deleted from this wonderful stupid fucking website and either way I’m gonna go out posting pictures of my cat

[lovingrot]

???????????????

[thingsfromthedirt]

this is how bad it is

[emperor-ing-deactivated20191108]

i told yall the review process is *also* automated lmfao

[meelktooth]

T-Those are mushrooms

[meangirlnurse]

sexy, sexy mushrooms

[threebigolsausages-deactivated2]

my favorite sport is jousting. except without the pole because thats too dangerous. just riding my horse angrily towards another guy riding a horse angrily, that is my passion

[cringeassremakingnaenaebaby-dea]

they’re getting rid of custom themes????

[cringeassremakingnaenaebaby-dea]

y’all deadass?

[thehauntedmansion2003]

if I see anyone posting anything that isnt catholic stained glass photos after the 17th I’m reporting you to the staff on sight

[mwg-drwg]

Incase anything happens to my account here’s my entire genome:

GATTTACTCGTACGGTACGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGYTTCCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATTAOCGGTACGATCCCGTAGGGTAGGGGGTTAATTGGCTCTGAGGGTTCTYCTCAATCCTCAATCAATCCTCHUATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGAATTCCAATCAATCCTCAATCATCAATCAACTCKAATCAATCCTCHATCTNACCCCCTTTAFCOGATCCCGTAGGGTAGGATCCTCATCTACCCTTCCTTTAFCGATCCCGTAGWGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTGATTTACTCGTACGGTACGATCCCGTAGGGTAGGGGGTTAAGGCTCTGIAGGGTTCCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGHCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATTACGGTACGATCCCGTAGGGTAGGGGGTTAATTGGCTCTGAGGGTTCTYCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCACGTAGGGTAGGGGGTTAAGGCTCTGAGGGAATTCCAATCAATCCTCAATCATCAATCAACTDCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCATCTACCCTTCCTTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTCATCTACCCCCTTTAFCGATOCCCGTAGGGTAGHGCCTCAATCATCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCHATCTACCCCCTTTAFCGATCCCGDTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCATCTACCCCCTTTAFOCGATCCCGTAGGGTAGHGCCTCAATCATCAATCCTCAATCCTTTAFCGATCCCGTAGGGTIAGGATCCTCATCTACCTCTTCCTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAOATCCTCTCAATCCTCAATCAATCCTCATCTACCCCCTTTAFCGATCCCGTAGGGTAGHGCCTCAATCATCAATCCETCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCATCTACCCCCTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTMTCCAATCAATCCTCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGG…

[puddingemoji-deactivated2025062]

DO ONE THING EVERY DAY THAT SCARES YOUR FAMILY

[mellifexfarm]

female-presenting nipples

[poupon]

truth coming out of her well to shame mankind (tumblr safe version)

[yocalio]

“female-presenting nipples”