The Secret Tumblr of Laura Palmer

i'm a socially manufactured creature designed to manipulate my way into the earth through my inflated ego and the gift of enhanced observation

[cynicalhippie]

This is my favourite part of UNHhhh ever. 

[snoopingasusualisee]

[jerryterry]

Visit Original Link

[awfulmidis]

[thenimbus-deactivated20200907]

NO FUCKING WAY

[saint-soap]

im self reblogging this because i went back and listened to the whole track and somehow this slaps harder than anything ive heard in the last week

[stelleo]

Via Chris Fleming

[lighterary]

“so this, witch in a bush, has the rubric?”

DEAD

[moontouched-moogle]

[pochowek]

judge: state your name and age young girl: (with the voice of a trailer announcer) PEGGIE 18

[axolotlanarchy]

[silenthill]

I have fucked to silent hill music in the past and WILL do it again so Akira yamaoka thank you for the prog Rock adjacency and pure tension that let’s me get away w that.

[silenthill]

@black-mountain-radio I’ve eaten Pussy for breakfast to Alone In The Town and I’m not about to stop at that.

[black-mountain-radio]

this town is full of monsters how can you sit there and eat pussy!?

[silenthill]

[wizardscheme]

Visit Original Link

SNIRBY

[bi-arikado-deactivated20200601]

Visit Original Link

[bi-arikado-deactivated20200601]

Visit Original Link

[screenageralex]

Being 18-25 is like playing a video game where you’ve skipped the tutorial and you’re just sort of running about with no idea how anything works

[rumbutt]

Being 25-30 is like later on in the game when you’ve figured out how things work, but have made poor leveling decisions along the way and are now horribly underpowered for what you’re supposed to be doing.

[daredussy]

sir that’s my emotional support cowboy 

[mwg-drwg]

Incase anything happens to my account here’s my entire genome:

GATTTACTCGTACGGTACGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGYTTCCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATTAOCGGTACGATCCCGTAGGGTAGGGGGTTAATTGGCTCTGAGGGTTCTYCTCAATCCTCAATCAATCCTCHUATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGAATTCCAATCAATCCTCAATCATCAATCAACTCKAATCAATCCTCHATCTNACCCCCTTTAFCOGATCCCGTAGGGTAGGATCCTCATCTACCCTTCCTTTAFCGATCCCGTAGWGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTGATTTACTCGTACGGTACGATCCCGTAGGGTAGGGGGTTAAGGCTCTGIAGGGTTCCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGHCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATTACGGTACGATCCCGTAGGGTAGGGGGTTAATTGGCTCTGAGGGTTCTYCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCACGTAGGGTAGGGGGTTAAGGCTCTGAGGGAATTCCAATCAATCCTCAATCATCAATCAACTDCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCATCTACCCTTCCTTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTCATCTACCCCCTTTAFCGATOCCCGTAGGGTAGHGCCTCAATCATCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCHATCTACCCCCTTTAFCGATCCCGDTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCATCTACCCCCTTTAFOCGATCCCGTAGGGTAGHGCCTCAATCATCAATCCTCAATCCTTTAFCGATCCCGTAGGGTIAGGATCCTCATCTACCTCTTCCTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAOATCCTCTCAATCCTCAATCAATCCTCATCTACCCCCTTTAFCGATCCCGTAGGGTAGHGCCTCAATCATCAATCCETCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCATCTACCCCCTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTMTCCAATCAATCCTCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGG…

[zenvanillacoke]

u: *saves the game* ur brain:

[your-instructions-from-moscow]

if you’re reading this, it’s too late

I already sent good vibes your way… they’re coming. there’s nothing you can do to stop them

[shitpost-senpai]

[ryo-maybe]

Mods are asleep, time to post Spanish doujinshi caps

[wyrmmaster]