Here We Go Again

Hoping to help with science accuracy in sci-fi fandoms! Ask me anything and debate me if I get anything wrong!

[nightgazeonastarmoon]

Hi!

About Me

(she/they)

I am an aerospace engineer in my 30s with an aging degree in astrophysics, specialized in imaging.

While I no longer work in the field, and therefore recognize that I may need a refresher on some subjects, I am still passionate about the wonders of the universe and have been trained to decode research papers and still possess a fundamental knowledge that I can share.

About this Blog

I created this blog because I'm excited to see the surge of interest in sci-fiction on Tumblr after the release of Iron Lung and Project Hail Mary, which I am very much a fan of!

I wish to contribute to these fandoms but, but having neither a talent for art, or writing, all I can offer is my penchant for the Sci in Sci-fi.

Therefore, among the fandom yapping, my goal is for this blog to provide a ressource for my fellow fans to get their easy science. My hope is that I can prove that science might be complex but it is accessible for all and, also, that it is infinitely fascinating.

I will try to post semi-regularly posts on various subjects relevant to PHM and IL primarily, although I am open to explore more sci-fi works, and to explore with you all what is accurate science and how fiction can work around the laws of nature to bring new worlds to life.

I'm also gonna yap fandom nonsense because I'm a big dumb nerd ✌️

Rules and Beliefs I Set for Myself

There are no stupid questions, only unknown answers.

Knowledge is never a pre-requisite to learn something, if we need to backtrack to the fundamentals, we'll do so!

I do not know what I do not know and, therefore, I open myself to criticism, debates and fact checking.

Science can only move forward by questioning everything we think we know. Therefore, I am happy to be told I am wrong!

SCIENCE MADE EASY FOR SCI-FI LOVERS INDEX

Subjects

Radiation

Radiation Shielding (Against X-ray and Inverse square law)

Sievert, Grey, Roetgen... how much is that? (Planned)

Relativity and Cosmology (WIP)

General Relativity (Planned)

Special Relativity (Planned)

Iron Lung

How to X-ray (unserious)

[meowkittyplier]

Hey guys!!! So i’m in the middle of protein synthesis cause i can do whatever tf i want, and i’m wondering if ANY of yiu can read the letters below the first strand

all those yellow lines have letters underneath (each is a strand of dna) so if you could type out the strand letters to me i would love that so much omg👀

i’m trying to put it into a google slide dec of the decoding for this photo, but my vision is cheeks so i’m gonna throw this out into the world and hope one of you catch it mid air😭

please? 🙁

[nightgazeonastarmoon]

I wanted to recheck, so I "beautified" it at the same time 'cause I didn't trust my pen and paper previous transcription AGGGTTTTGCAAACTGAAAGATCTGTAGAGAGTAGCAGTATTTCATT   

GTTGCAGTCACTGCACATGCTTTTGTTATAATTTGGAGCTTGAGCTGGAATAGTTGGAACCATCAACTTAGACTAATTATTCGA

GCTGAACTTGGTCAACCCGGAACTCTTATTGGAAACGACCAAATTTATAATGTTGCAGTCACTGCACATGCTTTTGTTATAATT

TTTTTCATGGTCATACCCATTATAATTGGTGGATTTGGTAACTGATTAGTACCTCTTATATTAGGAGCCCCGGATATGGCTTTT

CCTCGAATAAATAATATGAGTTTCTGACTTCTACCACCTTCCTTGACACTTTTACTTATAAGAGGTATAGTAGAAAGAGGTGTA

GGTACTGGATGAACTGTTTATCCCCCTCTGGCTGCAGCCATTGCCCACGCAGGGGCCTCGGTGGACCTTGGGATTTTTTCTGA? Now I'm pretty sure this is it... Only letter I couldn't be too sure was the very last one (marked it ?) Have fun now! :)

[nightgazeonastarmoon]

I need someone* to go galaxy brain on the fact that This

And That

are what passes for the Divine in Simon's universe and that this girl🎀⬇️ is the main Devotee to That⬆️

and that this "Angel" is the guide

to what passes as God's realm in this universe.⬇️

And, you know... what does that all do to someone's psyche? Specifically someone who has experienced all the consequences of the devotion given to This and That...

I think that would fuck up a guy.

I think that would make a guy see religion and the divine as torment, not comfort.

*Someone who is better versed in psychology than I am

[nightgazeonastarmoon]

I have a problem 🥲

Markimoo did not pay as much attention to the pressure gauge as he did the coordinates, I fear...

... wha... at what depth are we.... 😭

The hemostatic pressure at the skeleton is roughly 11200 psi, but they're in the "red" at 8400 psi 😵‍💫 That's a huge margin. Might be that because the gauge were not the focus at 4:14, it was overlooked and those are juste... not moving at all, actually

[nightgazeonastarmoon]

Ok, here's what we're gonna do.

I will do this in 2 (maybe 3) steps.

The first will be to highlight the fundamentals of craft design. Mind you, I'm an aerospace engineer, not a nautical engineer and, therefore, I'm going back to some fundamentals myself, even though many concepts apply to both, like material, pressure chambers, life support, fluid dynamics, etc. This will be the bulk of the final publication I make for this blog

Second, I will document everything we know about the SM-13 and figure out what each component does, its dimensions, systems, etc. The goal is to make that into a compilation of canon information on the SM-13, and supplement with hypothesis. I think I'll make smaller posts for each "chapter"

Finally, I will do what I do and expose what is fiction and what is accurate to a real life application. But that'll be last.

Yeah... that's a bigger undertaking than I had imagined at first but we're doing this 🫠

So, anyway, I will tag the process #SM-13 Retro-Engineering project

I'll still do the rest of radiation stuff and the guided tour to the 40-Eridani system 🥲 'cause the kind voters made it a tie. Other factors made the SM-13 a priority

[nightgazeonastarmoon]

View this post on Instagram

[nightgazeonastarmoon]

AXTFX's is great for a lot of Iron Lung BTS.

Hey, it's that sampler arm thing!

You know... it looks like it might be pressure activated... I don't think Simon needed to ram it at full speed...

Also, is it supposed to be a harpoon or a grab hand? Much to ponder about.

https://www.tiktok.com/@atxfx113/video/7641288642744356109

[dessathealien]

Hmmm... I think it's supposed for the middle piece to stab and lock/tear in some way (with the way it has "teeth" going on the opposite side of the tip, arrow tips like this are done so, if you try to pull through the way it went inside, it will tear the inside on the way out afaik for example), and the claw thing to probably ensure it won't fall down? But this depends on if like... on pressing the tip against something, it depresses and then the claw-part opens, and then as the tip go back to normal position, claw closes (this is my guess by looking at it). Maybe ramming at full speed was more to ensure the harpoon-tip would penetrate deep enough and have some sample cling to it?

[nightgazeonastarmoon]

It is possible that the movement shown in the video is more of a demonstration than how it's really supposed to work...

I suppose the way you describe it could work. But I feel like this would be a better concept of a sampler for flesh and soft tissues than brittle material like bones 🤔 I don't know all I can visualize is that it would pierce and shatter the bones but not necessarily grab unto anything that wouldn't fall off just after. 😅

Here's how I imagine it could work to be efficient:

1. Claw open until the target is touching a pressure trigger

2. Harpoon is pushed out with the force the mechanism allow (hence no need for raming it)

3. The claw closes to catch anything that falls.

Design flaw I see: that claw leaves much gap between it's finger, I can't figure out how the small pieces broken off by the harpoon wouldn't fall 😅

Solution to explain the instruction to ram:

- Ava didn't know how it work so she went with what came to her mind and it made sense to her

- The thing is broken (surprising no one) and the mechanism to punch the harpoon is faulty.

Oh! who knows! Fun to play with the concept tho!

For reference, this is what the skeleton looks like before and after the grab. That's a weird hole for that thing to do... so round 😳

We need forensic people's opinion on this, I fear 😩

Thoughts?

[nightgazeonastarmoon]

AXTFX's is great for a lot of Iron Lung BTS.

Hey, it's that sampler arm thing!

You know... it looks like it might be pressure activated... I don't think Simon needed to ram it at full speed...

Also, is it supposed to be a harpoon or a grab hand? Much to ponder about.

https://www.tiktok.com/@atxfx113/video/7641288642744356109

[nightgazeonastarmoon]

Can't decide on a subject for the next post I'll make for my Science for Sci-Fi fans Series so... huh... I'm letting the people decide.

What Should I Yap About Next?

More Radiation Stuff

Introduction on Relativity

Retro-engineering the Iron Lung

40-Eridani Star System

Propose a topic in the comments

Remaining time: 8 hours 21 minutes

For those unfamiliar with my blog,

I am an aerospace engineer and I have an aging degree in astrophysics (I do not work for NASA) I have recently been excited to see a passion for two sci-fi projects I loved that came out this year, Iron Lung and Project Hail Mary.

My goal is to reconnect with my joy of discovery and maybe interest a few people about science and, maybe, prove that science is wonderful and, actually, more accessible than one might think!

[nightgazeonastarmoon]

That ain't helpful you guys 🥲

(But I love your enthusiasm!)

[nightgazeonastarmoon]

Can't decide on a subject for the next post I'll make for my Science for Sci-Fi fans Series so... huh... I'm letting the people decide.

What Should I Yap About Next?

More Radiation Stuff

Introduction on Relativity

Retro-engineering the Iron Lung

40-Eridani Star System

Propose a topic in the comments

Remaining time: 8 hours 21 minutes

For those unfamiliar with my blog,

I am an aerospace engineer and I have an aging degree in astrophysics (I do not work for NASA) I have recently been excited to see a passion for two sci-fi projects I loved that came out this year, Iron Lung and Project Hail Mary.

My goal is to reconnect with my joy of discovery and maybe interest a few people about science and, maybe, prove that science is wonderful and, actually, more accessible than one might think!

[queerwyrd]

There is tree sugar in space!!!! A bloody patch of space!!!!!!???

[nightgazeonastarmoon]

Fun fact about space.

It just got everything in it. By definition.

We knew about the ethanol.

Now, we can make banger cocktails with those clouds 👍

[negative-pressure-ventilator]

Gravity of AT-5 (non-scientific bullshit)

This is probably going to end up being total bullshit, but I'll bring you along for the ride.

The scene where the sub/Simon are in free fall isn't as helpful as I had hoped it would be; Simon's fall is only on screen for about a third of a second, and there aren't a lot of good potential references for distance. Fuck it, I'm doing the math anyway. If I get 9.81 m/s² I'm deleting this blog.

Time

Had to pull this clip up in a video editor and skim through frame by frame to get the exact times. There's a total of 15 frames between when the sub impacts the surface and Simon hits the deck. At 24 fps, that means Simon is falling for approximately 0.625 seconds. His fall is only on screen for 8 frames/0.333 seconds.

Distance

This is trickier. The only thing in frame that I can use as a measuring tool is Simon himself. So fuck it, Simon's a ruler now.

Measured out 64 units and compared it to Mark's height (178 cm), so one unit is about 2.78 cm. Used the distance from Simon's shoulder to the top of his belt as a reference since that's what's on screen during his fall, which ends up being 16 units or 44.48 cm.

And now we move over to the first frame of Simon's fall:

Scaled up my shitty ruler and used frames from later in his fall to gauge where the center of his chest would impact the deck to get the distance. All in all we witness Simon fall 28 units, or 77.84 cm.

Calculating...

So I've got part of the distance that he falls, the time it takes him to cover said part of the distance, the total time it takes Simon to fall, and his initial velocity (0 m/s). Fuck. There's probably a formula for this but it's been too long since I took physics.

I can only get his average velocity during the period of time that he's onscreen, which is 2.34 m/s. The thing about gravity is that it's just a constant acceleration towards the ground; Simon's been in the air for 0.292 seconds already at the start of the shot, so his velocity isn't going to be zero. His velocity when he hits the deck isn't going to be 2.34 m/s either, it'll be slightly faster than that because again, average velocity. If I just say fuck it and use 2.34 m/s as his final velocity, I can plug that into a speed difference equation using the total fall time of 0.625 seconds and get 3.74 m/s² as his acceleration, but as soon as I plug that result into a distance via constant acceleration equation, I get 0.73 meters, which is less than the distance we witnessed him cover, aka it is wrong.

So basically, all I can say for certain is that Simon was definitely going faster than 2.34 m/s when he hit the deck, and that the gravitational acceleration is faster than 3.74 m/s².

I'll sleep on it and revisit it tomorrow. I'm definitely missing something.

@retrograde-raven @ctrl-shift-alt-9 I have failed you both

[negative-pressure-ventilator]

Take Two

I have returned freshly caffeinated with diagrams featuring my shitty handwriting. Changing my whole approach and treating this like an elevator problem, which I honestly should've been doing in the first place.

At Rest

Starting this off by establishing what forces are acting on Simon/the SM-13 before the fall:

The SM-13/Simon system are static right before the fall. The force of gravity is acting on both of them, but there is also an equal and opposite normal or "support" force canceling it out, resulting in a velocity of 0 m/s. That support force is removed when the SM-13's tether goes slack; now the only force acting on the SM-13 and Simon is gravity.

Start of the Fall

Without the support force, the SM-13 and Simon are free to accelerate towards the surface with a constant acceleration of X m/s^2. Simon appears and feels weightless because the SM-13 is accelerating at the same rate that he is. The floor is falling out from under him at the same speed that he is falling basically. Mass cancels out in freefall calculations, so don't have to worry about that. I'm ignoring air resistance; they're in the air for such a short period of time and the SM-13 is so dense that including air resistance in the calculations would probably only change the final velocity by a hundredth of a decimal or so. Also I don't have the atmospheric density, so I couldn't include it even if I wanted to. Yay.

The SM-13 falls for 93 frames; 24 fps makes that 3.875 seconds.

The SM-13 and Simon don't stop falling at the same time. The SM-13 is decelerated to 0 m/s (ish) when it impacts the surface, but Simon has been flailing like a feral cat, has rotated himself mid-air, is no longer in contact with the deck, and does not experience that impact force. He continues accelerating for another 0.625 seconds after the SM-13's impact with the surface and lands on the deck after accelerating for a total time of 4.5 seconds.

And this is about where I get lost because I cannot remember if I should be taking that 3.875 seconds of fall time into account when trying to find his final velocity, or if I should just be looking at Simon's acceleration relative to the sub and only use that 0.625 seconds. In my defense, it's been six years since I betrayed STEM and became an art major.

I'm taking a fucking break.

[nightgazeonastarmoon]

I have a suggestion.

around 58:15, Simon is stuck in the cave and just started working on the map when he gets up from the console to take a picture of his surroundings. He has a pen in his mouth. We know Mark's height, we can measure how high his lips are (in a non creepy way, lmao)

At 58:18-ish, he take a picture of Ellie and he drops the pen in shock. At 58:20, the pen has connected with the floor.

Gotta check how many frames that is, I'm not in a position to check that, and the moment the exact moment the pen is dropped is offscreen so it's gotta be made into an assumption, but that would give you an easier time than trying to elevator your way through this.

I expect it's gonna be 9.81m/s² unfortunately 😅 I've yet to see a sci-fi movie do gravity correctly. Maybe Interstellar? can't remember. Not even PHM did it on Erid...

You're super cool for this, tho!! that Mark-scale of measurement is 👌

Takes a lot of patience to start on a physics problem, even elementary, when you haven't gone to the math for these type of things in a long time.

[negative-pressure-ventilator]

Just how irradiated did Ava and David get?

(Been sitting on this one for about a week trying to find a solution with the variables available to me, and failing!)

At timestamp 00:31:49, the manual's radiation warning regarding the SM-13's x ray camera is on screen:

From the manual: "Upon activation, the camera discharges 7,400 millisieverts of radiation per ignition."

That's 7,400 millisieverts of radiation at the point of ignition. The fun thing about radiation is that it follows the inverse square law; double the distance from the source and the dosage received is quartered. So if Jack got the full 7,400 millisieverts (he didn't, there was at least some distance between him and the point of ignition so the dosage he received was probably slightly less than the full 7,400. But for now, I'm going to fudge it and say that he did to avoid the headache) then what dosage did Ava and David receive?

First have to figure out how far away Ava and David were from the camera. The only "definitive" point of reference that I have is David's/Troy Baker's height, which is 6'3"~ or 190.5 cm for my own sanity.

My first instinct would be to do a height/distance calculation by taking that 190.5 cm and dividing by the tangent of the angle from the camera to the top of David's head, however I don't have enough information to get that angle. I've been toying around with a few other ways to calculate the distance, but I'm usually missing at least one necessary variable.

Not giving up just yet, just taking a moment to bang my head against the wall.

Notably, if we establish that Jack was about 0.1 meters away from the camera and got hit with that full 7400 mSv, then if Ava and David were standing just 1 meter away from the camera, they'd only have gotten hit with about 74 mSv of radiation. That's about... 11-12 chest CT scans at once. For reference, your risk for cancer raises about 5.5% upon receiving a dosage of 1000 mSv.

So I guess for now the answer to the question of "just how irradiated did Ava and David get" is: not that much, actually?

[ctrl-shift-alt-9]

Thank you for doing the math. <3

[nightgazeonastarmoon]

What a coincidence! this is the second post I come accross about this subject today and I did a post about it yesterday too 😂 I'm linking mine here because I also discussed radiation absorption by the blood and maybe some people might be interested by that too?

Below is the table I made for how much radiation anyone else would have gotten in that hangar. My assumption was 7400mSv at 1ft (0.3m), which is already wrong probably but I'm trying to illustrate the Inverse Square Law, not publish a paper.

So for those who are curious about how much the dose drop based on distance

[badolmen]

There was a post somewhere complaining that Ava’s comment “you can apologize to my tumors” was erroneous because the poster believed she should have been developing symptoms similar to Jack and would not survive long enough to develop tumors, which is usually associated with chronic exposure to radiation instead of the acute dose she received.

However! I would like to point anyone interested in real life examples to the demon core. The first incident provided some interesting data about single acute exposure survival rates (guy Right Next to It died after 25 days. the guy 10 feet away lived another 33 years and died of cancer.) and the second was specifically studied to see how distance from the core at the time of exposure affected multiple people. Some that were in the same room died of natural causes in their old age!

What I’m saying is that it actually is likely that Ava (and David) would develop tumors later in life (or at least, a few years after exposure). They weren’t as badly irradiated as Jack (who was literally right next to the source of exposure) simply because they were further away. You can even tell in the X-ray they’re probably a few meters away on the other side of the room.

[nightgazeonastarmoon]

I made a post explaining how one can shield themselves from radiation just yesterday.

She got irradiated yeah, maybe to the point she now get a slightly higher risk of developing cancer but, it wouldn't have been the worst she experienced.

Below the table showing how much radiation she would have gotten based on different distance she could have been from the camera:

100 mSv is the annual dose clearly linked to an increase risk of cancer.

Jack is dead meat, tho. can't save him.

[nightgazeonastarmoon]

Shielding Against Radiation (Part 1)

In the following post, I will discuss the many mechanisms that can be used to protect an individual from each type of radiation, and the pros and cons of those mechanisms.

Refer to my main Post on Radiation (link in my pinned post)

DISCLAIMER: The following is for entertainment only. Always follow your local authority guidelines when approaching radiation hazardous areas. Do not attempt to use this as a guideline for self-experimentation.

A thing I don't think I truly need to say it but there be some wild stuff happening in the world sometimes 😭

Against Electromagnetic Radiation

As per the reference post, when discussing electromagnetic radiation as a source of ionizing radiation, we are discussing high energy photons, which is to say, photons with short wavelengths. These are known as x-rays or gamma-rays, depending on their energy level.

The energy of those rays is also the condition that make electromagnetic radiation ionizing (harmful) and non-ionizing (less harmful**). The ionizing effect start when we enter UV level of energy (just above the visible light spectrum)

**Please note that “Less harmful” refers to the type of physical damage expected upon exposure. For example, visible light is a form of non-ionizing radiation. However, looking directly into a strong light source may damage someone’s retinas! Your DNA is not expected to be affected, however 👍

The goal then becomes to lower the energy level of this radiation until it becomes non-ionising or null. This will happen naturally when photons interact with matter by the following phenomenon:

Photoelectric absorption (low energy interaction) ­­→ The energy is absorbed by the matter, which results in the emission of photoelectrons from this interaction.

Scattering (mid energy interaction, X-rays) ­­→ The photon is reflected by the matter, which can result in a change of direction (think of a bouncing ball). Scattering can lead to a reduction in energy (Crompton Scattering), which is an ionizing interaction, or not (Rayleigh Scattering), which is non-ionizing.

Pair Production (high energy interaction, happens at Gamma-rays level) ­­→ The photon “explodes” upon interacting with matter and creates a new photon with new energy and direction.

As we are talking about sub-atomic and atomic size interactions, it is important to remember that matter is actually mostly vacuum. All atoms composing a material are actually quite far from each other in comparison to their size and the physical effect of the existence of the material they create comes from the strength of the bond between these atoms.

Therefore, when discussing interaction between photons and matter, we must think in terms of probability, which is why everything has the potential to interact with this type of radiation, even air.

This also informs us on how to recognize an appropriate shield. Heavy or dense material, like lead (Pb), will absorb much better than light material like aluminum (Al). In the same way, composite material (which combines different elements) can offer better protection than a shield composed of each of their separate elements.

The probability of a material to interact with photons, and the type of interaction, is called the mass attenuation coefficient and characterizes how easy it is for energy to penetrate a material for a given mass of this material. This probability is affected by the type of material but also the energy of the photon.

See below a chart showing the mass attenuation of different interactions for different materials (note, x-rays are within 1.00E-03 (or 10keV) and 1.00E+00 MeV and gamma-rays are ranged above). These charts are called Photon Cross Sections.

eV stands for electron-Volt, a unit of energy (Such as Joules or Calories)

Example:

These are known by experimentation. The ray is shot at the material and a geigercounter (measure instrument of radiation) is positioned behind the shield to measure how much radiation passes through. The test is repeated for different energy level.

And here is a comparison of the total mass attenuation of lead, blood and stainless steel.

The best summary for this is the following: The higher the Mass attenuation coefficient, the more effective the material will act as a shield. As we can see, generally, the more energetic photons will interact less than lower energy photons.

Finally, we can know how much radiation will pass through a material by using the following formula:

Where I is the resultant intensity, I0 is the initial intensity, 𝜇/⍴ is the Mass attenuation coefficient, ⍴ is the material’s density and x is the thickness of the material

(as a reminder e is the symbol for Euler's number, a mathematic constant, like pi)

Let’s take stainless steel as an example. We want to shield against 99% of the radiation of a CT Scan, which operates at roughly 100keV, or 0.1 MeV.

And I/I0 = 0.01 (remaining 1% of the initial intensity value)

Conclusion, 0.62 in of 304 Stainless Steel would attenuate 99% of the radiation emitted by a CT scan.

In the world of Iron Lung, we can see that blood is a decent radiation "absorber". Meaning that the camera would most likely not have a very great range, 2m at most, to capture what's in the depth of AT-5.

To be noted as well that pair production would render any camera useless as the new photons created would create a massive amount of artifacts and debris in a picture. Therefore, despite the huge amount of radiation emitted by the camera, the energy put to the photons would probably be lower, which, in turns, translates to more photons shot than high energy photons.

It also means that, for the most part, very little radiation would make its way back to the Iron Lung — or its pilot.

Other Factors - Inverse Square Law

The other consideration to be taken when analyzing how much radiation would affect someone is the Inverse Square Law, which stipulate that the intensity of an electromagnetic radiation is inversely proportional to the distance from its source

Where ID is the intensity at a calculated distance.

For example, if I measure 1 mSv at 1m from the source of the radiation, I would measure ¼ of this intensity at 2m from the source, or 0.25 mSv

You can imagine this to be similar to how it is with a flashlight, the further you are from the flashlight, the less it illuminates your surroundings.

The following illustrate this law:

S being the Source, A being the subject and r being the distance, you can see that the further A is from the source, the less concentrated the rays are at its position.

If I was to put this in the context of Iron Lung.

This is the shot Simon takes in the hangar. Jack, the welder, is standing more or less in front of the camera. Ava and the Pilot are further in the background.

I have terrible depth perception and cannot estimate distances for the life of me so... I'll illustrate how much radiation Ava would have gotten based on possible distances.

Let's say Jack got the 7400mSv at 0.5m from the camera.

Conclusion, it is fair to suppose that Ava was mostly joking about Simon expected apologies to her tumors...

100mSv is roughly the yearly dose needed to see a significant increase in cancer risk.

Can't save Jack with science, however. R.I.P Jack.

References

https://www.osha.gov/ionizing-radiation/introduction/ionizing-radiation-equations

https://www.nist.gov/pml/x-ray-mass-attenuation-coefficients

https://www.makeitfrom.com/material-properties/AISI-304-S30400-Stainless-Steel

https://radetco.com/your-complete-guide-materials-that-block-radiation/

https://www.nrc.gov/docs/ml1122/ML11229A721.pdf

[iamonlyperson]

i know i have posted these before but in different angle(?) but something about just unfiltered sm-13 covered in blood hits different

atxfx

[wolfythewitch]

Thrifted a jacket with this blank white circle on it, so I stuck a project hail mary mission patch on top :D