h
occasionally subtle

izzy's playlists!

if i look back, i am lost

pixel skylines
Not today Justin
No title available

oozey mess
Three Goblin Art
Sweet Seals For You, Always

No title available
ojovivo

Love Begins
Game of Thrones Daily
No title available
Show & Tell
todays bird

JBB: An Artblog!
Cosmic Funnies
let's talk about Bridgerton tea, my ask is open

seen from Malaysia
seen from Ukraine

seen from United States

seen from Malaysia
seen from Germany
seen from Türkiye

seen from Malaysia

seen from Malaysia
seen from Japan
seen from Sweden

seen from Singapore

seen from Malaysia
seen from United States

seen from United States

seen from Singapore

seen from Malaysia
seen from Germany

seen from Malaysia

seen from Singapore
seen from Liechtenstein
@richiewhite
I HAVE WAITED ALL YEAR TO POST THIS
Everyone's like "The new Pope isnt welcoming to gay people and has covered up child abuse" like. Fork found in kitchen?
cr 豚鼠大boss (sound on)
the humble geiger counter as i walk through the cherobyl exclusion zone
reblog to teleport your mutuals to a massive party when jkr dies
when jkr dies i will tag every single person who reblogged this in a post btw
We were driving down the highway, and Derrick was going exactly the speed limit, like a psychopath.
He was aghast. "You wouldn't let me use your fuckbot?"
"It would be weird," I replied. "You're saying, in the hypothetical world where fuckbots existed, that you would be fine with me saying 'hey, I'm super horny, can I come pick up your fuckbot for the evening?'"
"Hell yeah dude," said Derrick.
"We're talking something that can make a reasonable pass at acting human, who looks human," I said. "That's what we're talking about right now."
"Yeah," said Derrick. "I mean, the kind of thing that realistically would end up being your maid, your chef, all that kind of thing, because if it can carry on a conversation it can probably do your laundry and scrub your tub and whatever."
"If, hypothetically, such a thing existed," I said. "I wouldn't call it a fuckbot, I would call it a domestic robot or something. Even if, for whatever reason, such an expensive labor saving device also had parts and protocols for having sex with it."
"And you wouldn't let me use it," said Derrick. "Not even just to try it out. Like if I was interested in buying one of my own."
"I mean," I said. "No, because you could just ask me what it was like, and I could tell you."
"That's bad market research, dude," said Derrick.
"Look, I'm not letting you have sex with my sexbot," I said. "That's a line that I'm not crossing, in the hypothetical world where domestic servant robots with like personalities and stuff are also ready and willing to have sex with you."
"Is it a hygiene thing?" asked Derrick. "Because I'm imagining like, a little sleeve thing that they could pull out and clean. And it's not like contagion theory is real, that's like, essentialism."
"What?" I asked. "Contagions are definitely real."
"No, I mean ... like this thing where if a knife has touched meat even just one time, it's forever a meat knife unless you do a ritual to turn it back into a dairy knife."
"What?" I asked again.
Derrick was still driving the speed limit. People were going around us, and some of them were honking. He was easily ten miles an hour slower than any of the surrounding traffic.
"The Jewish thing, with the knives," said Derrick. "You touch a knife to meat even once, and then it's a meat knife, and it doesn't matter if you put it in a like, immersion steamer or something."
"This is about keeping kosher?" I asked. "You're talking about whether a sexbot is kosher?"
"I'm saying that there's this idea, right, that if I put my dick inside your sexbot, that sexbot is forever tainted, and it doesn't matter if there's a sleeve that can be sterilized, or whatever, it's just this idea that the act independent of physical reality is ... a contagion, I guess."
"Surely there's a way of making a knife kosher again," I said. "I mean, surely, if you accidentally touch a knife to a piece of meat it's not a meat knife forever, surely you don't throw your favorite knife out because it's ritually unclean."
"I don't know man," said Derrick. "I'm just gesturing at the idea, you know?"
"I mean, there's probably some ritual cleaning or something," I said. "Can I look this up?"
"No," said Derrick. "I'm driving, I need someone to talk to, if I let you look it up you're going to have your nose in the phone for the next half hour, easily."
"Fine," I replied. "Anyway, I get the idea, and it's not that I think it's like ... magic or something, like you using it would metaphysically alter the sexbot. It's more like ... in my mind, it would be my girlfriend, right? Or like a girlfriend replacement. If you can't find a girlfriend, store bought is fine, that kind of thing."
"Interesting," said Derrick. "I was thinking of it as a sort of ... maid, I guess. And if you hired a maid, and she said to you 'hey, I'm super horny basically all the time, so if after I'm done cleaning, or if I'm in the middle of cleaning, and you want to have a go, I am basically always up for it, then ... I mean, you might, right? And you wouldn't be surprised if she was having sex with other people. And if you explained this to me, and I said 'hey, can I get her number', you'd give me her number, right?" He glanced over at me. "Right?"
"I guess in that case, she would have agency," I said. "And it wouldn't be the same. Because if I hired a domestic servant robot, I would be extremely surprised to find out she'd been having sex with other people, like ... when I was away ... or something."
"But you'd give me her number, right?" asked Derrick.
"In this scenario, is this maid ... a sex worker?" I asked. "Like, is the understanding that I'm paying her for cleaning the house and sexual availability?"
"Nah, I don't know dude," said Derrick. "You know, when you think about it, a combination domestic servant and fuckbot is kind of fucked up. Like, misogynistic."
"Does it get less fucked up if it's a guy?" I asked.
"Honestly, yeah," said Derrick. "That's practically progressive."
"I mean, it's sort of inherent to the concept of a sexbot," I said. "I don't know how you do one of those that's immune from criticism. And calling it a fuckbot doesn't help. I mean, it's a facsimile of a woman, whose only purpose is doing domestic labor and having sex."
"And there's this power dynamic thing," said Derrick. "Like, you own her, right? And you tell her whether or not your friends are allowed to have sex with her. No agency, like you said."
"So you think that me loaning out my sexbot to you, in this hypothetical, is a win for feminisim," I said.
"Honestly, yeah," said Derrick.
"Well, I'm still not going to do it," I said. "I'd feel weird about it."
"I think it's this girlfriend mentality," said Derrick. "Like, girlfriend replacement, that's probably not a healthy way to think about a fuckbot."
"We said illusion of sentience, right?" I asked. "Like, it can carry on a conversation with you, and you mostly won't notice anything weird? Because if that's the case, it's kind of weirder for it not to be a girlfriend, or something like a girlfriend, like if it's only doing all the household chores and the cooking and cleaning and you have sex with it, and it's perfectly capable of asking how your day is or expressing interest in how you're doing in League, but you just don't talk to each other? That's weird. And seems less healthy than just carrying on a conversation."
"Yeah, maybe," said Derrick. "But like ... no way anyone is going to be your girlfriend if you have a fuckbot, that's a real concern."
"In this hypothetical world where someone like me without a huge amount of extra money can afford a domestic robot, I think attitudes would change," I said. "On dating apps or whatever you'd have people tagging 'robot friendly!' or 'absolutely no robofuckers' or whatever. And I would assume that women would have them too, and then when I did get a girlfriend, she'd move in with her own domestic robot, and I'd make peace with the fact that sometimes we'd have sex together and sometimes she'd want to just have her sexbot please her."
"Totally not what would happen," said Derrick. "You're trying to create some kind of normalcy around this? Like you'd just be in a little, I don't know, polycule with two robots?"
"I mean, they're sub-sentient robots, so no, not a polycule," I replied. "Part of the premise is that they are, in fact, incapable of cognition as we know it, that they don't actually have emotions or ambitions or agency beyond what's programmed into them. If we're saying that they're effectively humans but made of electronics and not meat, that's totally different, all my answers have to change."
"And if they did have emotions," said Derrick. "If they did have agency and cognition and whatnot, then —"
"Then they'd be slaves," I said. "And I'm not cool with slavery, so I wouldn't have one."
"What if they were volunteers?" asked Derrick. "If they had emotions and thoughts and all that other stuff, and they came off the factory line really wanting to be fuckbots and domestic servants."
"Sketchy," I said. "But ... maybe, depending on the details."
"And in that case, if they had agency of their own, would you let me have sex with your fuckbot?" asked Derrick.
I rolled my eyes. "Alright, fine, if the sexbots were fully human-level intelligent with agency and emotions and wants and dreams, and it seemed like the robot I lived with was actually interested, yes, I would give my blessing."
"Niiiiice," said Derrick.
Another car came up fast behind us and swerved into the other lane to avoid us, honking as it blew past.
"Can I ask why you're driving so goddamned slow?" I asked.
"Oh, I was doing it as a bit, I wanted to see how long it would take for you to notice."
Derrick smiled at me, then put his foot on the gas.
You know I turned on the sound just to help me understand what was going on and I guess it was exactly what it looked like.
yarrrrrrrrrrrrrrrrrrr you greedy fucks
"We keep making our service worse, cancelling shows before their time, hiking up the prices, and generally ruining what once was a decent product--piracy keeps wining somehow. 🤷"
This is especially funny because early on, part of Netflix's business model was to look at what series were being pirated and acquire them, and a lot of pirates would just use Netflix because it was easier and not too expensive.
But then Netflix made themselves infinitely more inconvenient and you'll never guess what happened next
what’s happening with santa
I think my mom's getting him pregnant
has tumblr heard about the saga of raefarty yet
Me Giving a Pressed Conference: our advocacy for the disabled must include the addict, the imperfect victim, those we despise; the right to autonomy and life cannot devolve into a popularity contest
Reporter I Hate (Not Sexual Tension): Does that include all the attendees of the Bored Ape NFT event who went blind
Me: *Blood streaming from my nostrils and eyes* david, it includes everyone
can't keep that in the tags
only 5 seconds
i wasn't ready for that..lol
Immediately recognized that look
this post's hypothetical by itself is already ridiculous but the thing that gets me is how the wording implies two very funny things that become funnier in tandem
1. "Accidentally, the pitcher tosses a Christian baby" means this is a mistake on the pitcher's part. i imagine the pitcher is breastfeeding on the field and they pitch and they look down at their hands and they see the ball still in the glove and they go "fuck"
2. hitting the baby will still win you the game
String identified: tt'ttcataactttgtatgttgttgtatcta ."Accta,ttctaCtaa"atatattc'at.agttcatgtattcatattaattattgatg"c" .ttgtattga
Closest match: Gallinula chloropus genome assembly, chromosome: 5 Common name: Common Moorhen
(image source)
I want to see the pitcher who can get a live baby into the strike zone.