Bea!

She/They beesblog.com

[isuggestforcefem]

One day i will feminize all men

[isuggestforcefem]

I will be solving the “male loneliness crisis.” By removing males

[were--ralph]

Coke would misgender you

Pepsi would try but still get it wrong

Dr Pepper would get it right every time

[were--ralph]

Coke would call you a slur (derogatory) and mean it

Pepsi would ask if they can call you a slur

Dr Pepper would call you a slur (affectionate)

[necromancelena]

Computer loves to be like "fuck! You sure you want to shut down? Youve got volume mixer open"

[beatricethestrange]

no Jon don't do it!!!

[cosed]

there is no temptation greater on earth than that of museum gift shops

[tamamita]

Ireland is the only country in Europe

[drag-on-dra-goon]

[girldog]

dogs can use “DOG BEAM”. which has an effecvt on you which is whatever the dog wants

[kittiescatlover]

Every body wants to be friends with kitty but Ultimately its kittys choice

[furryprovocateur]

they should allow you to report posts for being gauche or passé

[girlswater]

[chipinett]

I'm trying to make illustrations for each of the fears, starting with the Buried, the Corruption, the Desolation, the Lonely and the Dark !

[were--ralph]

[isuggestforcefem]

I can't believe "Misandry is real" is a real opinion that people hold. What a joke

[isuggestforcefem]

But with your help,

[transhuman-priestess]

Tumblr did not “Goncharov” Poob. Poob is Glupp Shittoing Tubi/Pluto/Roku Channel/Hulu/etc.

[gender-luster]

none of these words are in the bible. or the dictionary, for that matter.

[hugintheraven]

#While this is a joke#For the etymologists out there#Tumblr did not “goncharov” poob#translation: Tumblr is not making a fictitious thing called poob that we insist is real#Poob is glup shittoing (streaming services)#Translation: Poob is now a generic name for whatever streaming platform is out there when you don't feel like naming something specifically

[disregardcanon]

[frociaggina97]

"i don't care if they make their whole way though uni with chatgpt" i think you guys are so internetpilled that you have forgotten there are actual jobs out there that require people to know what they are doing in any way possible or else people die

[frociaggina97]

i know a lot of people study just to get paid well but girl this is engineering be for fucking real take this seriously

[boybeetles]

I do find it really funny when people say they listen to trans guys and then you find out it’s their one trans guy tumblr mutual who hasn’t touched a single book about transmasculine related theory. They just know one guy and act like he’s the CEO of trans men.

[digital-realms-420]

[cryptid-sighting]

patch notes for Forest: deer have beam attacks now

[rainyydoves]

she genetic code on my genome till i GATATATAGGACTAGATAGTA

[hellsitegenetics]

String identified: gtc c g t GATATATAGGACTAGATAGTA

Closest match: Metridium senile genome assembly, chromosome: 5 Common name: Fluffy Anemone

(image source)