We Apologise For The Inconvenience

[scarletbirbs]

This is the best ad I've gotten since they added the Tumblr Blaze feature thank you tumblr user plaguerightsactivist for using this new feature correctly

[trowelsanddirt]

by will mcphail

[the-catto]

iT's fUnY beCAusE mEn aRE DumB

[addictedtocaring]

No dumbass, it's funny because women are usually left out of these pictures. And most of history. While actually, you know... living full lives and contributing to society. Just like men do. But men are always in the fucking picture.

This isn't a comic about men being dumb, it's a comic about women being forgotten, ignored, and excluded. But you were so ready to be pissed at mean feminists that you took something personally that absolutely wasn't and got offended by something that wasn't being said.

[cheesyradfem]

The artist was a man but women still got blamed for the “misandrist joke” by a redpiller calling himself a “big dick americhad“

[she-volution-deactivated2022052]

i love this dude he’s made a bunch of other ‘misandrist jokes’ as well

[pwesident]

poisons you with a poison that works immediately

[mxkoifish]

oh my god i feel it immedia

[pwesident]

poisons you with a poison that works immediately

[mxkoifish]

oh my god i feel it immedia

[boethiah]

thank you for sending assassins after me btw i really needed that. it meant a lot to me

[sacredstem]

tumblr dosent count as social media

[william-snekspeare]

tumblr counts as a terrarium

[trashcat-ops]

you know, the more I think about it, I don't think there were ever any "Russian spies" or "Russian chaos agents"

I think those were just normal tumblr blogs bro

[velvetys]

Just found out what sea shanties is... I thought it was this thing

[lucifurby]

[popokko-deactivated20210315]

i think i will become a creature.

[popokko-deactivated20210315]

*scuttles*

[roboco-san]

my best feature is that I'm blindingly intelligent for about 30 seconds a day

[roboco-san]

I do not get to choose which seconds. they are not consecutive

[lesbianshart-deactivated2016082]

[twocubes]

slept in today, what’d I miss?

[zvaigzdelasas]

go back to bed

[fed-durst]

[bogsorcerer]

Satan tempting Jesus in the desert

[papasmoke]

Please list your full genome sequence in your bio

[papasmoke]

Louis | 24 | Bi | They/Them | GATTACATACCTTACTTATTACCGATAGGGCAGATTACGGACCTATTAGATTACATAGATAGGGGAAAAAACATAGATACATACGTAGTTGCTCGACACTAGATTACAGATACTAATATTTTGATACCCAGGTTAGACGATTACAGATTACATTACAGGATACCGATGAGGATAGGACGATTACATACCTTACTTATTACCGATAGGGCAGATTACGGACCTATTAGATTACATAGATAGGGGAAAAAACATAGATACATACGTAGATTACATTAGACCATAGGTTGCTCGACACTAGATTACAGATACTAATATTTTGATACCCAGGTTAGACGATTACAGATTACATTACAGGATACCGATGAGGATAGGA | White

[papasmoke]

People are telling me that this genome sequence is "too short" and "doesn't match any known organism" and if my genome looked like that i would be "dead" but maybe those people simply haven't optimized their genomes like I have

[avvocarlo]

sounds like someone is a little TOO mentally ill… goodbye!

[blanketsandanime]

Hiring managers

[valtsv]