luv's hoard of stuff

he/it || 19 || read pinned!

[something-with-luv]

this is a verrrry wip pinned post!! be warned!!!

--

Heya!! I'm Luv. :)

I draw stuff & occasionally write :)

DNI if you are proship and whatnot, please! you will be blocked on sight. thankies :)

i reblog a lot of nsft shitposts !!! i try my best to tag them (usually as nsft, nsft shitpost or cw suggestive) — be warned!

--

other sideblogs i have

@writing-with-luv - writing blog! mostly for reblogging but i might write something in the future

@loving-with-luv - NSFW/NSFT blog that i may also write for in the future [minors DNI / 18+ only !!]

i put a lot of tags on reblogs (as of 09/12/2023 lol), popular ones i use being #funnies (for shitposts, memes, & whatnot), #queue (with luv), (for queued posts), #animals and #yearning :)

[exciting]

fights I would pay to see: sigmund “everyone is attracted to someone” freud vs John “sexual desire is evil and cereal can and will fix it” Kellogg

[moonlitdremr]

Asked my mom who both has a MA in psychology and currently works for Kellogg’s to weigh in for the hell of it

[dwagom]

enemies to lovers 500K slowburn

[phoenix-effigy]

@batmanisagatewaydrug

[batmanisagatewaydrug]

okay but consider: Sigmund LOVED cocaine

[imissthembutitwasntadisaster]

"I know chatgpt is bad but you just don't really have any choice" you literally do. Don't use it. Have some moral backbone.

[birdsareblooming]

it's been like 2 years. i havent touched it. never needed to. "you don't really have a choice," are you so swift to forget the recent past? Bitch i still use itunes to download mp3s to so i have them forever and any song i want, then my sister burns them to CDs. When boycotts rolled out my other sister got no thanks to scan what products we shouldn't buy. i still use corded headphones not because "its older" but because it's easier. a fool criticizes those who buy candles 200 years after the invention of the electric light until the power goes out. become ungovernable. you are not immune to propaganda. you've never had Chatgpt forced upon you, the only thing forced upon you is the idea that Chatgpt is forced upon you. why claim you need something today that you didn't need yesterday. little bitch.

[teophan]

[the-smart-name]

[youareinacomawakeup]

AND YET IT WAS REAL

[clarificationsw]

I watched the part with AOC and he was so strange about it lmao I love hbomberguy so much

[tsukomuuuuu]

IT WAS HBOMBERGUY??

[clarificationsw]

he's always on the strangest shit I love him

[crazy-pages]

Look given how much sleep he was operating on and how much money he raised, he gets to be as weird as he wants

[bemusedlybespectacled]

"he's kinda fallen by the wayside" HAVE YOU FORGOTTEN ROBLOX_OOF.MP3 ALREADY?

also i want to make it clear that Harris Bomberguy Brewis was fucking congratulated by the fucking Scottish Parliament for his livestream

dude isn't even Scottish

[do-angels-dream-of-starry-seas]

The way this entire post goes and you have the tags try and sincerely say Hbomberguy was a relative nobody who fallen to the wayside

[charlesoberonn]

Hbomberguy could fall into a coma for 7 years and then wake up and make a video about the history of linoleum tiles and it'll blow up online.

[lesboevils]

idk im really tired of 15-17 year olds who have never interacted with the gay community irl and spend too much time on tiktok trying to act like the authority on all that is lgbt+ 

[lesboevils]

  mean this in the kindest possible way. if you are too young and unsafe to go to your gay community center or pride here’s some ways you can connect to gay history.

the oral history project from act up

the lesbian herstory archives

the transgender archives of the university of victoria

the digital transgender archives

glbt historical society (digital)

lgbtq digital collaboratory

[lesboevils]

since it was suggested in the tags

anything that moves

the bisexual manifesto

[lesboevils]

the Samuel Proctor oral history project

a masterpost of lesile feinberg’s works by @genderoutlaws

more to come

[lesboevils]

the queer zine archive

the dyke march compilation 

paris is burning 

how to survive a plague

united in anger: a history of ACT UP

one archives

new york public library lgbtq archives

[agentravensong]

characters who see themselves as more of a Force or an abstract concept acting in the world than as a person. characters who prioritize their role as a cog in some greater mechanism over their own personhood. characters who get their hands dirty, who run themselves ragged, who take on an unbearable weight, who hurt or neglect or give up or straight-up betray the people and things they once held close, because they believe in doing so they are fulfilling their Purpose, the thing they exist in this world to do (and no one else will do it, *can* do it, so it has to be them). characters who've determined that they are constructs bound to preprogrammed code, to a script already written for them by someone/something else, and have been operating under that mindset for so long that they don't know how to live on their own terms. characters who uphold the fate that is smothering them. can anyone hear me

[sacred-portal]

[tlirsgender]

I heart prey animal rage I love when characters are fucking insane with terror

[tlirsgender]

When they're not dangerous like a hunter but dangerous like a spooked horse kicking your skull in

[tlirsgender]

Let's hear it for prey animal rage let's hear it for killing everyone else in the world before you'll let them catch you

[slimetony]

Just tried to play an ancient flute and it started filling the room with this awful miasma that wont go away

[slimetony]

Why does staff still allow people funnier than you to leave tags on your posts. They should have fixed that by now

[etherealascend]

[transmechanicus]

[randomalienencounter]

||𝙹⚍ ᔑ∷ᒷ ⊣𝙹↸↸ᔑᒲリ ∷╎⊣⍑ℸ ̣

[everest81-deactivated20250126]

Randomalienencounter you've shown me beautiful things

[randomalienencounter]

╎ᒲ ⊣ꖎᔑ↸ ||𝙹⚍ ᓭᒷᒷ ℸ ̣⍑𝙹ᓭᒷ

[everest81-deactivated20250126]

I have no clue what you say and yet your words soothe me like no other

[randomalienencounter]

ℸ ̣⍑ᒷ∷ᒷ ᔑꖎ∴ᔑ||ᓭ ∴╎ꖎꖎ ʖᒷ ᓭ𝙹ᒲᒷ𝙹リᒷ ℸ ̣⍑ᔑℸ ̣ ∴╎ꖎꖎ ⍑ᔑ⍊ᒷ ||𝙹⚍∷ ʖᔑᓵꖌ

[the-haiku-bot]

ℸ ̣⍑ᒷ∷ᒷ ᔑꖎ∴ᔑ||ᓭ

∴╎ꖎꖎ ʖᒷ ᓭ𝙹ᒲᒷ𝙹リᒷ ℸ ̣⍑ᔑℸ

̣ ∴╎ꖎꖎ ⍑ᔑ⍊ᒷ ||𝙹⚍∷ ʖᔑᓵꖌ

Beep boop! I look for accidental haiku posts. Sometimes I mess up.

[alexiaroselikethewine]

so this implies that the haiku bot knows how to translate alien

[187onabuster-deactivated2025013]

its beginning to suck a lot like penis

[sweatymasc-deactivated20260101]

the ten commandments

thog don't caare

if it sucks hit da bricks

play the cards i'm given

pobody's nerfect

this mess is a place

fuck it we ball

it's so over

we're so back

what if the world was made of pudding

there is good in every day

[hellsitegenetics]

String identified: ttcattgtcaatctacatcagcttaacctatacattaagtga

Closest match: Diaphora mendica genome assembly, chromosome: 5 Common name: Muslin Moth

[sacred-portal]

[doomdaysdecays-deactivated20251]

if i had to explain what tumblr is like i’d only show this

[the-moonbug]

No one seems to be acknowledging the far funnier element of this, which is, that when you go to the commenter’s account, you find out they are actually fucking roleplaying as a sexually repressed skeleton and jjst really committed to the bit while everyone in the reblogs is talking about how much they hate minors or whatever. thank you kharak the skeleton servant of the almighty lich king

[the-moonbug]

“I hate this website” “I hate purity culture” “asexuals are so annoying” “religious people are so annoying” “I can’t stand TikTok gays” “I hate minors” you guys are talking about a skeleton warrior who serves an evil wizard right now

[valentina-poem]

[weather-n-calamity]

Bitch I don’t even know you. And you’re a deer.

[vvarhound]

[cannibalchicken]

tag yourself i'm prairie madness

[derinthescarletpescatarian]

Human minds are like "if you make me experience boredom or disappointment I am checking the fuck OUT"