space bugs?

[papasmoke]

Please list your full genome sequence in your bio

[papasmoke]

Louis | 24 | Bi | They/Them | GATTACATACCTTACTTATTACCGATAGGGCAGATTACGGACCTATTAGATTACATAGATAGGGGAAAAAACATAGATACATACGTAGTTGCTCGACACTAGATTACAGATACTAATATTTTGATACCCAGGTTAGACGATTACAGATTACATTACAGGATACCGATGAGGATAGGACGATTACATACCTTACTTATTACCGATAGGGCAGATTACGGACCTATTAGATTACATAGATAGGGGAAAAAACATAGATACATACGTAGATTACATTAGACCATAGGTTGCTCGACACTAGATTACAGATACTAATATTTTGATACCCAGGTTAGACGATTACAGATTACATTACAGGATACCGATGAGGATAGGA | White

[papasmoke]

People are telling me that this genome sequence is "too short" and "doesn't match any known organism" and if my genome looked like that i would be "dead" but maybe those people simply haven't optimized their genomes like I have

[elliscky]

Unfinished shot - layout of a stray cat in Asturias, Spain

[notallmensheviks]

[rumman]

what's one direction

[rumman]

oh cool thanks

[dreamico]

its 5am

[c3po]

what's your type?

type of what

[itwashotwestayedinthewater]

Blood

[c3po]

oh red

[whitepeopledreadl0cks]

[ewaneneollav]

[love-freak-deactivated20190805]

[ange-l-of-musicals]

cinematic parallels

‪brokeback mountain (2005) ‬|| ‪night at the museum (2006) ‬

[monotonyasylum]

[zesbian]

Obsessed with this sponsored post I just got on instagram by Antoni Queer Eye telling me to go to therapy

[pukicho]

mount Rushmore redesign on the house

[kvistwig]

It’s sacred land, we really shouldn’t!

[pukicho]

Ah my bad let me just

and then just

[stilllifequickheart]

Giovanna Garzoni

A Bitch

1648

[avant-sad]

um, rude? let her enjoy her snack in peace

[mysharona1987]

[socialdistancing]

[hellolovelyscientist]

can’t hid these in the tags, because this is all true

#It is precisely the same thing America says about guns#too bad so sad#some of you are gonna die#healthcare same thing#social security same thing#i’m so disappointed by my country

[polkadotmotmot]

Martha Goetz - Petal Paws, 2020