Kiana Khansmith
Not today Justin
art blog(derogatory)
tannertan36
pixel skylines
❣ Chile in a Photography ❣
hello vonnie
🩵 avery cochrane 🩵
No title available
KIROKAZE
"I'm Dorothy Gale from Kansas"
gracie abrams
TMBGareOK. The Official They Might Be Giants tumblr
Sweet Seals For You, Always
Product Placement
titsay
Jar Jar Binks Fan Club
𓃗
Cookie Run:Kingdom Official!
almost home
seen from United States
seen from Malaysia
seen from Malaysia
seen from Malaysia
seen from United Kingdom
seen from Jamaica
seen from France
seen from Poland
seen from Hong Kong SAR China
seen from Indonesia
seen from Canada
seen from Malaysia
seen from Singapore
seen from United States
seen from China
seen from France
seen from United Kingdom
seen from Malaysia
seen from Albania
seen from Türkiye
@freddyhair
you know how in greek myths people who die tragically sometimes get placed among the stars by the gods?
call that
call that a
Its okay, take your time
constellation prize
in my defense they did not specify the order in which i was allowed to take my time!
Dear God these tags are immaculate….
I love them all!
follow me... for adventure and wonder
I recognize this still!
It’s from my favorite croc gif!
Look at ‘em go!
this is so beautiful i might cry
be free
the ten commandments
thog don't caare
if it sucks hit da bricks
play the cards i'm given
pobody's nerfect
this mess is a place
fuck it we ball
it's so over
we're so back
what if the world was made of pudding
there is good in every day
String identified: ttcattgtcaatctacatcagcttaacctatacattaagtga
Closest match: Diaphora mendica genome assembly, chromosome: 5 Common name: Muslin Moth
America be like "you cant have free healthcare or easy access to disability but you can have a gun"
no healing, no living, go KILL
This post was really fucking funny in hindsight
Killing 68,000 people was United's choice.
Murder by algorithm is wrong.
The fact that you can’t raise taxes on billionaires even slightly without them pouring money into fascist political movements is, of itself, evidence that billionaires as a class shouldn’t be allowed to exist in the first place.
I’d just like to point out that every single thing that has happened in the 6 years since I created this post has only reinscribed its absolute moral correctness in my mind.
No you dont get to keep that in the tags
La creatura.
ily, menswear guy
not normie enough to fit in but not fringe enough to lean into being a freak, worst of both worlds, pure liminality, just the weird coworker, and unrelatable classmate. and your mutual
we are in a media literacy crisis
friendly reminder that characters don't need to be saints to be entertaining. and telling a story does not mean endorsement. art does not need to be all about morally good people.
IDK if this was meant as hyperbole but it's literally true:
Adult literacy is low.
Child literacy is low.
Information literacy has shifted dramatically in the last decade, but reputable information sources like research journals and factual news reporting have been unable to keep pace.
We are genuinely in a crisis of media literacy, with ever fewer genuinely factual resources available in the style and language used by contemporary audiences.
It may sound condescending, but we genuinely need to remind people, or worse, explain to them for the first time that art is not evidence of real world behaviour.
So, thank you, for this reminder. Genuinely.
You're correct:
Art does not need to feature exclusively morally pure characters. Art is not proof of the creator's secret, violent desires.
ETA; Yes, the links are US American; no your country is not immune to propaganda. Be POLITE in asking, and I will help you find the data for your own country as well.
Remember that Mercedes commercial with chickens? Wobbly Works did one with Microraptor: https://www.youtube.com/watch?v=tvMrACaQjlw
omg
he took a bath 3 times
his name is Organic Spinach
the cleanest frog in Michigan
if i had some kind of deal as a kid where a frog was at the bottom of bags of spinach i would have easily eaten five times as much spinach
Trying to get people to realize birds are full on actual no holds barred dinosaurs on the internet is like playing a constant game of whack-a-mole
The game never ends there's just another mole to whack
whack whack whack
I understand that you guys aren't being totally serious, but birds are categorically NOT dinosaurs. They're BIRDS. Being descended from and very similar to an animal does not make them literally the same.
Bats are mammals. If every mammal except for bats went extinct, bats would still be mammals. This is what happened with birds. They're a type of dinosaur that evolved within the dinosaur evolutionary tree, and existed alongside other types of dinosaurs until all those other types of dinosaurs were wiped out. Surviving when the other dinosaurs went extinct doesn't mean they stopped being dinosaurs at any point.
@arctic-nimbus I am not joking, I am being serious. Birds are living dinosaurs.
Dinosaurs are defined as the most recent common ancestor of [Theropods] + [Sauropodomorphs] + [Ornithischians], and ALL OF THAT ANCESTOR'S DESCENDANTS
hence, because birds descend from that ancestor, ALL BIRDS ARE DINOSAURS THE END.
I am a paleontologist and this has been known since 1996 please stop making me play whack a mole. this is googleable. this is on wikipedia. this is in most paleontological sources. this is in the literature. this is in books. this is in jurassic park. this is on this blog in many places. this is on other people's blogs in many places.
this is, or should be, common. knowledge.
fin
Okay, your condescending reply aside, you haven't addressed the elephant in the room which is what I brought up in the other thread. I'm descended from a fish. That doesn't mean I am a fish. You telling me that birds are living dinosaurs doesn't make any difference to me because you haven't made a convincing argument why I should categorize them that way as oppose to another way.
Where do you draw the line between them being living dinosaurs and them being something else?
In biology and paleontology, evolutionary groups (clades) are defined to be monophyletic. That is, a clade contains all descendants of its most recent common ancestor. No lineage ever stops being part of a clade, no matter how much it has evolved. If you're descended from a member of a certain clade, you are in that clade.
Dinosaurs are a clade, which is formally called Dinosauria. Because it's defined as a clade, then everything that is descended from a dinosaur must also be a dinosaur. Ergo, modern birds are a subgroup of the clade Dinosauria.
Think of it this way. Sauropods, ankylosaurs, therizinosaurs, and birds are each very different from their early ancestors, which would have looked kinda like this:
And yet no sauropod, ankylosaur, or therizinosaur ever stopped being a dinosaur, regardless of how much they evolved. So why would birds be any different? By the same standard that Argentinosaurus, Tarchia, or Therizinosaurus are dinosaurs, birds are dinosaurs.
And yes, humans are lobe-finned fish (Sarcopterygii). The standard applies everywhere.
No, humans are not lobe-finned fish.
That's called an absurdity.
Perhaps by your definition of reality, humans are lobe-finned fish, if I accept the schema that you so lovingly shove down my throat.
But there is nothing more or less scientific about looking at lobe-finned fish of today, and comparing them to humans, and finding they are completely different things.
So your argument is inherently an opinion! It is a normative statement, not a fact. Stop representing it as a fact.
but it is fact
just because you don't want it to be doesn't mean it isn't
It is a fact though because that's how common descent works.
Humans evolved from an ancestral ape, and are still apes.
That ape evolved from an ancestral mammal, and it was still a mammal. So we're also mammals.
That ancestral mammal evolved from an ancestral tetrapod, and was also a tetrapod. So we're also tetrapods.
And that tetrapod evolved from an ancestral lobe–finned fish, so it was also a lobe–finned fish. So we're also lobe–finned fish.
This hierarchy of descent is what modern taxonomy is built on. Organisms are classified into groups based on common ancestry, like I outlined above.
A group made up of the last common ancestor and every descendant of that ancestor is called a 'clade'. Clades are the groups that we classify in taxonomy.
Every descendant of a clade is by definition part of that clade, similarly to how you're still in the same family as your great great grandparents. You can be very different from your grandparents but you'll never stop being related to them.
Humans can be very different from other apes, mammals, tetrapods, or lobe–finned fish but that doesn't mean we stop being related to them, and it doesn't mean we don't share ancestors with them.
Because we use these patterns of relatedness to classify organisms we're part of each of those groups by definition.
Ok so, here's a style of diagram that I've found pretty useful for understanding how animals still remain in their ancestral groups. Each group is contained within the wider group, so whales are within ungulates, which are within mammals, which are within synapsids, which are within tetrapods, which are within sarcopterygii. Lungfish and coelacanths are the only other living groups of lobe-finned fish, and are our closest non-tetrapod relatives.
It's a very simplified diagram sure, I've left out many many intermediate groups in service of making my point clearly without clutter. But hopefully it gets the point across that no matter how granular and detailed you get with the groups, they never stop being inside the larger group they evolved from. You can't cut out birds and transplant them outside of dinosaurs, they are by definition a member of dinosauria.
Also just to be clear, this is not some made-up opinion held by a little group of dinosaur nuts. This is literally The Standard Method in modern science of classifying living things, this is just how it works.
Also @arctic-nimbus if you're so adamantly against birds being dinosaurs, do you also not believe that whales or bats or humans are mammals? And if you do why one and not the other? I'm genuinely asking here because I don't understand why people are so selective when it comes to birds being dinosaurs specifically.
okay but arctic nimbus is right like; yes, within taxonomy birds are dinosaurs and humans are fish but like, y'all're also ignoring the central point. which is that taxonomy is a social construct, just like the family you compared it to. its arbitrary boxes, created by humans, with very little reflection of or practical use in reality. it is a valuable part of the scientific religion, but it is, like the rest of science, at its core faith based, and largely irrelevant
the names we use and the lines we draw are decided through a lot of messy historical vagueness, but lines of descent and the interrelation of species is an objective reality. Lungfish are more related to humans than they are to tuna, tyrannosaurus is more related to sparrows than it is to a triceratops. That's not social construct, that is the current understanding of a physical, natural reality.
If you don't think it matters to you then ignore it, don't argue with people whose passions and/or jobs are discovering the very real, very physical relations between organisms. Does "fish" mean "non-tetrapod vertebrate" to you? Sure, knock yourself out, but if you want to understand zoology you have to disavow yourself of that notion.
and for what it's worth, i do in fact think that understanding that birds are a type of dinosaur helps understand dinosaurs (which can be small, intelligent, and probably colorful and loud too) and birds (which can be powerful, dangerous, and are reptilian).
people will literally fucking declare phylogeny a social construct and declare science to be faith before they accept that birds are a type of dinosaur how are you so stubborn about this
Not sure if you purposefully misunderstood them or not, but they were saying that taxonomy, TAXONOMY is a social construct. They never made any claim about the way evolution works. It is a fact that the groups we define these creatures into are socially constructed, invented by humans, and also that those creatures and the way they evolved still exists in reality, because those are two separate things
So again, within the framework of modern taxonomy i don’t thing anyone but that weird nihilist arctic nimbus disagrees birds are dinosaurs, but it should also be recognized that the framework of modern taxonomy was created by humans and as much utility as it has, it’s still socially constructed
Also science is faith based but people need to understand that at least when i point that out im not saying science is a religion im saying people (for good reason) have huge amounts of faith in the scientific method and thats what upholds it.
Folks need to stop doing the transphobe thing and thinking “socially constructed” = “not real” or “bad and needs to be abolished”
so I get what you're saying here but just because taxonomy is a social construct doesn't mean it's not describing something "real" (whatever reality is)
ie, a monophyletic group (a clade) is a single evolutionary unit
that is a real thing
and so by defining dinosaurs as a clade we are talking about them as a single evolutionary unit
which is a useful idea because it allows us to measure evolution
much as units of measurement for length or weigh allows us to measure physics
yes, how we define and what names we give them are arbitrary, but the idea that some things are some lengths or weights and some things are others isn't
and, similarly, the idea that some things share evolutionary groups while they don't with others (or at least, recently, given we're all related) isn't arbitrary
so when scientists scream that birds are dinosaurs, what we're really saying is that dinosaurs didn't stop evolving, they're still here, they're doing better than ever, and the "age of mammals" is a myth, so humans aren't the pinnacle of evolution, and shouldn't destroy the planet for our own amusement, bc we aren't the main characters of earth. no one is.
WHACK WHACK WHACK
I get what everyone is saying here but also words can have multiple meanings.
Humans are fish in the cladistic sense where "fish" is defined as "anything evolved from a fish", because humans did.
Humans are not fish in common parlance, where the definition is fuzzier but usually runs something along the lines of 'aquatic vertebrate with gills and no limbs'. People argue about that the specifics of that definition in various contexts as well, but e.g. if a sign says that it's legal to catch fish in a river nobody's going to agree that this means you can kidnap people from the river on the grounds that people are fish.
Birds are dinosaurs in the cladistic sense where "dinosaur" is defined as "anything in the Dinosauria clade", because all birds are.
But there's also a common usage of the word (which is usually the first listed in major dictionaries) that's something like 'any of a particular group of extinct reptiles from the Mesozoic era', or 'any fossil archosaur with hind limbs directly beneath the body' or some such, and this definition, which is fuzzier, still obviously does NOT include modern birds, because they didn't go extinct at the end of the Mesozoic.
None of these definitions is "more right" than any other, they're just different amounts of useful in different contexts.
This kind of nonsense is how we got "tomatoes are not a vegetable"
False.
This is significantly more like “oh hey you know how we thought diseases were caused by miasma? Yeah it was germs the whole time.”
It's not though. You are using the word dinosaurs in a way that it reasonably could be used, to refer to a monophylectic group, but in colloquial speech it is not usually used in that way.
This whole discussion is a bit like someone saying, "Nails are made of metal" and you saying "That's ridiculous, nails are made of keratin." It's that level of intelligence going on here.
No, because dinosaur has never, ever meant the colloquial meaning. It has only ever meant the scientific one.
Lots of people think “woman” means “person with vagina”. Doesn’t make them right.
