i will never forgive marvel for making Loki and Sylvie romantic instead of letting them be the chaos twins we deserved...the sibling energy was immaculate and then they just...ripped it away
2025 on Tumblr: Trends That Defined the Year
Sweet Seals For You, Always
No title available
Keni
AnasAbdin
Show & Tell
Not today Justin
Game of Thrones Daily

PR's Tumblrdome
NASA
Claire Keane

祝日 / Permanent Vacation
🪼

blake kathryn

JVL
hello vonnie
Mike Driver
noise dept.

❣ Chile in a Photography ❣
Sade Olutola
seen from United States

seen from United States
seen from United States
seen from United States
seen from United States
seen from United States
seen from United States

seen from United States
seen from United States

seen from New Zealand
seen from United States
seen from United States
seen from United States

seen from United States
seen from United States
seen from United States

seen from Malaysia

seen from United States
seen from United States
seen from Greece
@magnificentfreek
i will never forgive marvel for making Loki and Sylvie romantic instead of letting them be the chaos twins we deserved...the sibling energy was immaculate and then they just...ripped it away
Follow me on Twitter for more vampire nonsense
human: dude you've been in our d&d group for literally like three years, you don't need to keep asking if you're invited every time
vampire: i knowww, i just get anxious ok?
human: oh fair
I feel personally attacked. Lol
Mike never said he won’t come back he said he might not be HEAD writer for s2 (which inspires no hope in me tbh.) but if he & Kate leave the only other incompetent writer that needs to be booted is Eric Martin who literally only got the job because he’s Mike’s friend (which is funny because they’re BOTH incompetent!).
Anyways what shouldn’t be at all shocking & what I expected when Mike was announced for the show was that he also head-produced Rick&Morty which is the sort of cheap shlock writing that the Loki show got (especially with all the unfunny quippy jokes & the edgy self-romance that is a “metaphor” despite no chemistry, no good writing, and Sophia making this face 😐🤨😐🤨😐😟😐🤢 whenever she’s onscreen w/Tom. Love her to bits but the woman was NOT playing a lovestruck girlie.)
Lets start manifesting that tweedle dee & tweedle dumbass leave after tweedle doofus already left 🙏 Or at least get smaller fucking authority in the script room.
If he's involved with the series in any capacity and if his cronies like Eric Martin stay I don't see how there can be any change. More offensive insulting garbage. So yeah. Disney's gotta get rid of all of them if there's any hope. Hope they boot them off the show but I'm not holding my breath. Also hope that if they get rid of them they bring back actually competent people in their place who also CARE ABOUT AND UNDERSTAND AND ARE PASSIONATE ABOUT Loki's character. Wish they'd bring back that thor 1 writer who still apparently really likes loki and tweets about him a ton and also Kenneth Branagh. but it's disney so we'll probably just get more garbage instead.
All this time I believed, I KNEW that Mobius isn't gonna betray anyone or turn out evil.
I mean... just look at him! He's literally embodyment of kindness and compassion.
Alexa, play NEVER GONNA GIVE YOU UP.
Was I supposed to know Eric Andre is bisexual or was I just supposed to find that out in an article about him being racial profiled from a month ago?
does this look like something out of his comfort zone
Hello important information!!!
Bread is NOT part of a skeleton's natural diet and feeding it to them can make them sick. Instead try: coins from countries that no longer exist, dead batteries, ballpoint pens, or brass buckles. These are much closer to what skeletons eat in the wild :)
I live in a coastal region and I generally feed the local skeletons with broken seashells collected during low tide, which are high in calcium and other natural minerals. Very occasionally, such as for celebrations such as last night's solstice, a shard of broken ancient pottery makes a great treat, but be careful, as these are sometimes cursed, and may cause issues for some skeletons.
Our local skeletons really like corks. And they go bonkers over tinfoil, but I haven’t been able to find solid info on if it’s a safe treat for them or not.
Why does the entire rest of the internet think tumblr is “dying” or “dead” when I have seen absolutely no drop in activity level on here ever
Would you rather twitter and reddit people move back here? I think it’s good people think we’re dead
( despite the massive drop in activity since *the incident*, my timeline has been way more sane since then too )
don’t tell anyone we’re still here. we like that everyone thinks we’re dead.
“I can’t believe Tumblr is dead.”
*in the distance* “Yes, keep telling people we’re dead!”
“Sometimes I can still hear their voice.”
*in the distance* “No you can’t, we’re dead!”
I love it,but don’t tell
[ORIGINAL WORDS BY @ewanmcgregorismyhomeboy12]
EDIT: this is a quote from the movie KUNG-FU PANDA 2. This is just a fun joke, and is not intended to be taken seriously.
Please list your full genome sequence in your bio
Louis | 24 | Bi | They/Them | GATTACATACCTTACTTATTACCGATAGGGCAGATTACGGACCTATTAGATTACATAGATAGGGGAAAAAACATAGATACATACGTAGTTGCTCGACACTAGATTACAGATACTAATATTTTGATACCCAGGTTAGACGATTACAGATTACATTACAGGATACCGATGAGGATAGGACGATTACATACCTTACTTATTACCGATAGGGCAGATTACGGACCTATTAGATTACATAGATAGGGGAAAAAACATAGATACATACGTAGATTACATTAGACCATAGGTTGCTCGACACTAGATTACAGATACTAATATTTTGATACCCAGGTTAGACGATTACAGATTACATTACAGGATACCGATGAGGATAGGA | White
People are telling me that this genome sequence is "too short" and "doesn't match any known organism" and if my genome looked like that i would be "dead" but maybe those people simply haven't optimized their genomes like I have
Things I’ve seen in Covid19 as an ICU nurse:
- a husband and wife admitted to icu, positive for covid after sending their two teenagers back to school when it opened. She coded and died yesterday. We wheeled her body into his room so he could say goodbye to his high school sweetheart from his hospital bed. We dont expect him to survive.
- 94 year old man, married to his wife for 64 years, both tested positive after a single visit to their dentist. It was the only “outing” they had since March. Because there are so few beds available, they were sent to separate hospitals. She stroked and died shortly after. He watched her funeral on FaceTime and never got to say goodbye.
- a 25 year old who flew home from another state because his mom was afraid and asked him too. He tested positive 3 days after his flight. He died 20 days later in our ICU.
- a father/son duo who run a manufacturing company, tested positive along with the majority of their employees. They both came to our ICU. Dad died. Son was able to leave the hospital 30 days later - he learned of his father’s death after leaving, for fear of impacting his recovery.
- A schoolteacher, working for special needs children, tested positive 1 week after her school mandated they reopen. She died 10 days later. Her last words before we intubated her were, “Im going to be your next survivor!” We told her she was right, but we all knew it wouldn’t happen.
- a 45 year old woman with a 6 and 8 year old at home. After 65 days, she never woke up due to hypoxic brain injury. She never made it off a ventilator.
- tiered nursing models, where ICU patients are being cared for primarily by nurses without ICU experience while one ICU rn gets placed as a “supervising” nurse over 5 ICU patients, and monitors the regular nurses care over them. Your loved ones not getting the appropriate level of care deserved because we have no staff left to care for them.
- patients who should be in ICU unable to come to the ICU because there are no beds available. Left on the regular floor in hospital with no additional supervision or coverage because there’s not enough staff to do so.
- patients that have been sent from out of state because their home areas have no room to take them. When these patients are close to end of life, their families are hard pressed to arrive in time to say goodbye.
- a unit opened as a tiered-staffing ICU where there is no negative pressure in patient rooms and no way to install them per maintenance. Nurses are going to be required to wear PAPR during their entire shifts without taking them off while working in that unit. So 12 hours without drinking water or eating unless you can leave the unit. Which it being tiered staffing - its not safe for the ICU rn to leave because there will only be 2 ICU nurses on the unit.
We are a long ways from having herd immunity with the coming vaccines. Please wear your masks. Dont go where you dont absolutely have to go. Wash your hands. This is not the time to go on new dates, have family gatherings or big game nights or get together. Please. You have called the nursing profession “the most trustworthy” for decades - and now when we beg you to listen, to wear a simple mask and social distance, you call us liars and the trauma we see these patients go through every day a conspiracy. Please. We are breaking.
Remember!
2020 may be over, but the pandemic isn’t
what’s a good cutoff age for tumblr
no one should be on tumblr
I met the woman of my dreams on Tumblr ^_^
I met the man of my dreams on Tumblr 👀😁
i met a girl who made a hate blog about me and threatened to leak my nudes!!!
Legit: Buy Actavis promethazine cough syrup ” lean drank purple” @ $200 per 16 oz( Hi tech, qualitest also available @ $150 per 16oz).text 281-819-7927. Grab yours now!!Payment by western union/money gram or pay with debit card online easy.I accept half payment upfront and half upon delivery ONLY on special offers like:$600 for 3 pints of actavis$700 for 4 pints of actavis$900 for 5 pints of actavis$1,000 for 6 pints(half case) of actavis$1,700 for 10 pints of actavis$2,000 for 12 pints
I have had at least two people tell me that I am mentally unwell and need to get psychiatric help with no context or reason
This post is a wild ride from start to finish
Fun fact: in the 80′s the Dutch Unemployed Union held ‘fridge raids’ to protest against poverty.
They’d find out when a politician of big boss who upheld poverty and starvation wages was speaking at some public even, then they’d carefully break into his house with a LOT of people and they would eat EVERY piece of food in his house and leave the empty dished behind without taking anything else.
Direct action at its finest.
I theoretically disapprove, but at least it’s ballsy as fuck.
I no longer disapprove.
Growth
jedi master ahsoka tano……..
She's NOT a jedi
Bo-Katan: I’m here to fight you for the Darksaber! You are unworthy, unfit to be a ruler and leader of Mandalore—
Boba, Fennec, Cara, Greef, The Armorer, Din’s entire clan, Ahsoka, all of Corvus, Peli, Cobb + all of Mos Pelgo, Frog Lady, Frog Husband, Mayfeld, Omera + the entire village, Luke, R2-D2, every single Force Ghost, and like three different Tusken clans slowly forming a protective barrier around Din:
Grogu, front and center with his brand-new lightsaber:
“When mom says no, I just ask dad”
.
.
RIP Anakin:
I have a commissions page!
yes but i get to choose the ribcage