NASA
Aqua Utopia｜海の底で記憶を紡ぐ
❣ Chile in a Photography ❣
art blog(derogatory)
Three Goblin Art
Kiana Khansmith
DEAR READER
wallacepolsom
Kaledo Art
RMH
almost home
occasionally subtle
"I'm Dorothy Gale from Kansas"
No title available
Monterey Bay Aquarium
let's talk about Bridgerton tea, my ask is open
ellievsbear
YOU ARE THE REASON
Product Placement
Peter Solarz
seen from Venezuela
seen from United States
seen from Kazakhstan
seen from United States
seen from Malaysia
seen from Guatemala
seen from United Kingdom
seen from Namibia
seen from United States
seen from United Kingdom
seen from China
seen from United States
seen from United States
seen from United States
seen from United States
seen from Malaysia
seen from United States
seen from Türkiye
seen from Malaysia
seen from Greece
@odetoeyes
Should be "sorry, not sorry" then. Because if you cared, you wouldn't spread this crap on somepony else's property. So, the only sorry you are is a sorry sack of sh!t. You humans annoy me to no end.
If you did this to my house, I just might break your bucking arm.
okay
My desktop wallpaper cycles between these two images so every 10 minutes I am overwhelmed by the loss of my horse or overcome by the fear of its return.
naked: normal naked
naked with shoes on: super naked
naked with Black Knight Halberd: dark souls speedrunner
funniest thing about seeing tumblr mentioned on other websites is the people who are utterly confident that tumblr is exactly as it was in 2012. like we're a bug trapped in amber.
saw someone on reddit mention you gotta be careful making fun of Taylor Swift on tumblr because the Swifties will get you. there are like 8 swifties on this site and they're playing dolls in their own corner.
"careful, an SJW will call you a shitlord for saying that 🤣🤣🤣" sir we use exploding car hammers these days. in fact the exploding car hammers are even a little dated.
"the fangirls are gonna hunt you down for insulting their fave" most of the fangirls are men now.
and most of the fanboys are women
Saved my heart from the fate of...
just once i'd like to go on a date without joe biden
just once i'd like to go on a date without joe biden
without joe biden
@wooftphr
it continues
what is your favourite colour and why
favorite color is teal, favorite why is wherefore
"Dodge this."
"My original character Gunfield, who is Garfield's brother but with a gun."
How would you die in Willy Wonka’s chocolate factory?
this is a great question because it narrowed my soul! i would choke on regular chewing gum on the steps outside before even entering the factory. willy would make no attempt to perform the heimlich maneuver and would leave my corpse on the concrete
String identified: accatacttagattcatacgacggttttgtactaatttttcaaactcctcgccgtagtaatctacatacatatatttagaacgaatacatatatataat
Closest match: Eutolmus rufibarbis genome assembly, chromosome: 1 Common name: Robber Fly
(image source)
stop eating coffee cakes with the lesser drakes and come drink from a flagon with an elder dragon
when i was in middle school nickelodeon on directv broke and it froze on the same frame for five hours. which would not have been so bad, except it was during the episode of spongebob where he goes to live with the jellyfish. specifically the scene where he’s naked and covered in sea urchins and flopping all over the place trying to get them off. and it froze on the frame where spongebob was facedown on the ground, naked. so he was laying there like that in complete silence for five hours. we would change the channel back every so often to see if he’d gotten up, but he was still like that when we went to bed. none of my friends had directv so when i asked them the next day they hadn’t seen it, but my brother and i were pretty convinced that spongebob was dead.
date of origin: December 20th, 2015
kissing through a knights helm and sucking the strap are ontologically quite similar, in that you CAN really feel it, as long as you are Pure Of Heart
my coworker was brushing out a really fat pug and I went "they used to load these things into canons during the civil war" and she went "really?"
My daily jaunt in the abyss
let's form structures with mamas
these are hyraxes! they're not rodents or canines or anything like that. they belong to their very own order known as hyracoidea. their closest relatives are elephants and manatees, and these mamas and babies have FREAKY teeth
also important to note that the
and:
the title of the last song you listened to is the epitaph on your tombstone
