Mike Driver
No title available
🪼
Product Placement
Show & Tell
blake kathryn
oozey mess
occasionally subtle
JVL
No title available
★
sheepfilms
taylor price
#extradirty
No title available
Game of Thrones Daily
todays bird
art blog(derogatory)
titsay
❣ Chile in a Photography ❣
seen from Malaysia
seen from United States
seen from Russia
seen from United States
seen from Türkiye
seen from Malaysia
seen from Germany
seen from United States
seen from Vietnam
seen from Mexico
seen from Malaysia
seen from Saudi Arabia
seen from Bangladesh
seen from Malaysia
seen from United States
seen from United States
seen from Spain
seen from Malaysia
seen from Hungary
seen from Brazil
@resentfulshrimps
hey just a thing uh. No fundraisers please.
A.) I do not have the reach you would need to actually raise any money your energy is better spent elsewhere.
B.) I do not have the ability to properly vet people sorry.
If you dm or ask about it regardless I am assuming you are a bot and blocking. Sorry.
Thank you have a nice day.
sorry to everyone who liked this blog btw I had to leave tumblr for my mental health. I wish I didn't come back with such vitriol but idk situations warrant different reactions. I wish social media and the internet was a good place to talk about dream games and look at beautiful ocean animals but that's not true anymore. And that makes me sad. Very sad. But it is what it is I guess.
So for those of you that aren't on BSKY and haven't seen all of this yet; screenshots were posted on twitter of Sam's [one of the heads of YNO iirc] transphobic comments that led to him being kicked from PokeRogue. Shared them on bsky and think people here deserve to see them too. Also give context for everything else I'm about to share. Here is the bsky post, there's a decent bit in the replies and none of it is good.
Remember kids. Hate with a halo isn't holy it's fucking blasphemy. If you truly believe god is good and you say shit like this on your god's behalf, then either you are awful or your god is. And I think it's obvious where my opinion lands there.
i need feminism because when jesus does a magic trick it’s a goddamn miracle but when a woman does a magic trick she gets burned at the stake
fabulous
i mean they did also kill jesus. that was a pretty significant thing that happened. like i understand where you’re coming from here but they very much did kill jesus.
#HAPPY GOOD FRIDAY
get in losers we're killing caesar.
An emergency arbitrator ruled that former Meta staffer Sarah Wynn-Williams is prohibited from promoting memoir of her tenure at the social m
Hey did you know there's a tell all book about the behind the scenes of Meta and the author is forbidden from promoting it?
The good news is however that it's already published and can't be stifled and whoever didn't sign the NDA can promote it as much as they want.
You mean Careless People, written by Sarah Wynn-Williams?
Available from Macmillan Press?
Careless People, written by Sarah Wynn-Williams?
this book? about Facebook? What an interesting topic!
CARELESS PEOPLE A Cautionary Tale of Power, Greed, and Lost Idealism by Sarah-Wynn Williams Preorder your copy today ON SALE NOW Amazon Barn
what is THE worst thing you've ever drank. all liquids acceptable. please tell me what it was, bonus points for why
Hey whoa hi. Hello. I am looking directly into your ear canal. What do you mean you drank a tube of virus concentrate.
So, I was working in a lab, right? My job in the lab was preparing a pure, concentrated enough sample of virus. This is tricky since, y'know, viruses require hosts to replicate, but you then need to get the host cells (and the pieces of the host cells that died!) out of the sample while still keeping the viruses. Once I'd finished and the samples had been sent to the database for analysis as well as a second one sent to be frozen for future reference, there was still some left over that needed to be disposed of.
I, knowing that this was a once in a lifetime opportunity, waited carefully for the lab director to be deep in conversation with someone else on the other side of the laboratory. And then I took my chance.
Test tubes, as it turns out, are really bad as shot glasses. Their shape turns any liquid inside into a stream, so you really can't knock it back quickly - it takes a couple seconds. Additionally, the best way I can describe the taste of virus concentrate was "sterile rot". A very unique kind of bad! Made worse by the test tube's inefficiency as a shot glass.
(by the way we were studying bacteriophages, not animal viruses. these viruses are too specialized on attacking prokaryotes to even recognize our cells as targets at all, according to studies.)
(but also like. if the viruses managed to successfully switch hosts and killed me with a violent infection, itd still be worth it.)
(for science.)
You have a fitting blog title
this post is getting 50k easy
String identified: atTttgaaacctaatattataagcttacaaataaatcctatagaagttaaagacctatgaTtccttcattttgtttcatcttctatttatgtcataatttataaaaaaactttctatttattgtattaacatttatcatacttcatttttaatAttcacTttatttaaaatgaTatatataacatctaccttaaccAtattacacttatcctatattAaattttccaatgatatgactagtaatatcaattacgattcgcatagtataaccgtttataagtcctctatatctttttccaattggttttgttga
Closest match: Holothuria sanctori genome assembly, chromosome: 6 Common name: Variable Sea Cucumber
(image source)
everythingistb.com
Rock urchins By: Unknown photographer From: The Grolier Illustrated Encyclopedia of Animals 1994
You know what they say about urchins :D
i made a terrible bio error in this post
i was thinking barnacles, sea urchins are external fertilizers, much like our beloved crinoids. Though slightly less cool. Only slightly though.
all i want is to get hellsitegeneticsed. i want to know what kind of creature my post is. god i want it to be something cool sooooooooo bad do you think they have the genetic code for werewolves
String identified: aattgttgtcattatcattgattttgcattatgtcc
Closest match: fucking badass werewolf Common name: hell yeahhhh
so this is what it's like to be god's favorite
scientists in the 1990s, putting a Get More Purple gene attached to a harmless plant virus into an already purple petunia: please get more purple
the petunia, sensing an apparent honest to god Get More Purple Disease, using the previously undiscovered RNAi antiviral ability to shut down all other purple genes along with it just in case: you put VIRUS in petunia? you infect her with the More Purple?? oh! oh! her children shall bloom white! jail for mother, jail for mother for One Thousand Years!!!!
Btw the thing this discovered is like. A foundational lab technique now and has revolutionized genetics
String identified: ctttttgaGtgattactaaattaaataagtttagaaatttgGtagtcAataatttatgagtttcattactttcatatatTaatttgtcAataatcaatgtc
Closest match: Luzula sylvatica genome assembly, chromosome: 3 Common name: Great Wood-Rush
(image source)
i did a redraw
1986-1993 Toyota Supra
String identified: at at t c ! atatc! GA ! ! -Tta a
Closest match: Callophrys avis genome assembly, chromosome: 9 Common name: Chapman’s Green Hairstreak
(image source)
Rock urchins By: Unknown photographer From: The Grolier Illustrated Encyclopedia of Animals 1994
You know what they say about urchins :D
more agony
he is going to hell
“you support gay rights so you must be gay”
i support animal rights do i look like a fucking alpaca to you
turns out i am gay
holy shit how’d this alpaca learn how to type
Diversity win! The alpaca is gay!
he was a llama
a llama?! he’s supposed to be dead!
String identified: “ t ga gt t ga” t aa gt a cg aaca t t t a ga t ’ t aaca a t t t ! T aaca ga! a a aa a aa?! ’ t a!
Closest match: Cardamine chenopodiifolia genome assembly, chromosome: 6
(image source)
Cardamine chenopodiifolia!? He’s supposed to be a llama!
I hear tell that it’s the year of the snake - I think this is the only snake-centric illustration I’ve ever drawn? But she’s got a real I Will Fight To Make Things Better energy that I think we’ll need in 2025.
