Lacy @yurimaster72 - Tumblr Blog

dogpuppy

happy moon day

#Moon day

grimeclown

“hi welcome to mcdonalds what can i get for you?”

“yeah can i get a deluxe quarter pounder with cheese?”

“absolutely, do you want the meal or just the sandwich?’

“uuuuuh hold on”

*fishes something out of my pocket*

“mikey what do i do?”

“get the fries. youll need the energy in the coming days”

*stuffs it back in my pocket*

“uhh yes please the meal would be great”

hellsitegenetics

String identified: ctcaatcagtacagtaattcatattattactgtctatgtttgtcgattacctatagat

Closest match: Udea ferrugalis genome assembly, chromosome: 11 Common name: Rusty Dot Pearl

(image source)

rumplefuckingstiltzkin

Getting the fries because now more than ever we will need the energy in the coming days.

alagaisia

Hey. Why isn’t the moon landing a national holiday in the US. Isn’t that fucked up? Does anyone else think that’s absurd?

alagaisia

It was a huge milestone of scientific and technological advancement. (Plus, at the time, politically significant). Humanity went to space! We set foot on a celestial body that was not earth for the first time in human history! That’s a big deal! I’ve never thought about it before but now that I have, it’s ridiculous to me that that’s not part of our everyday lives and the public consciousness anymore. Why don’t we have a public holiday and a family barbecue about it. Why have I never seen the original broadcast of the moon landing? It should be all over the news every year!

alagaisia

It’s July 20th. That’s the day of the moon landing. Next year is going to be the 54th anniversary. I’m ordering astronaut shaped cookie cutters on Etsy and I’m going to have a goddamn potluck. You’re all invited.

watermelon-converse

Hey. Hey. Tumblr. Ides of March ppl. We can do this

emi--rose

Hell yeah moon holiday

hello-delicious-tea

Ooh coming up we should celebrate

ariaste

PITCH: We call it Moon Day, and then every 7 years when it falls on a Monday, that's an even BIGGER deal and we call that Moon Day Monday and go absolutely apeshit about it (the next Moon Day Monday is in 2026 so we have a couple trial runs first)

sarostheghostcat

MOON DAY MOON DAY MOON DAY

wafflebloggies

moon day is 20th July!!!

silly-jellyghoty

Scheduling this a day earlier to remind you all and myself about the Moon Day tomorow!

sashaforthewin

Happy moon day to all who celebrate

kitsuneofthemist

This is your reminder to prep for Moon Day on July 20th.

superpeanutgarden

Moon day Monday is SOON!!!!!

5p4rkl3-c0ll3ct1v3

in weirdcore, it’s always “wake up you have to wake up” and never “I like this place, I want to stay here”. Can we please normalize that second one?

demilypyro

"if Jax is a trans woman she's still an abuser so she's bad representation so the show is transphobic" you're an idiot. you want your blorbos to be perfect ideal angels, I want my blorbos to be realistic, nuanced, flawed human beings, we are not the same. I LIKE that she's messy and fucked up and problematic, I think it's a realistic depiction of how a lot of repressed and traumatized trans women are. I think the show goes to great lengths to explore how and why she is the way she is, and to evoke sympathy for this kind of person. it doesn't excuse her actions but it does make them understandable. and I think the fact women like that deserve sympathy is an idea worth stating and worth shouting. yes she's a bully and she hurt everyone around her and that may never change. she still deserves sympathy.

strange-aeons

Haters and Preps beware!!!

segamascott

neiljostenpussyindulgence

I love gay people theres a guy in my neighborhood who named his one singular dog “simon and garfunkel”

izizwild

Part 1 of a day in the life of the Haikaveh household

Soooo I’m really new to the fandom (and to posting art too!!) and I would love some friends to nerd out about genshin with… so if anyone wants to be friends I would be so so happy lol🥺🥺🥺 I feel like I have no idea how to make online friends rippp

lovelyveraa

Alhaitham to Kaveh

heyy!!! follow me on art fight!! maybe even attack... i do revenge!!!

#art fight #ocs #artwork

lakevida

i bet the pain will end if i arrange a perfect enough sentence about it

madphantom

You know, there's this cliché that teenage boys always eat massive amounts, but teenage girls really aren't that different if they're not suppressed by diet culture and body shaming. Like, I was a teenage girl who frankly just stopped bothering to fit into mainstream beauty ideals at some point, and I would regularly make myself just one big massive pot of pasta and devour it completely. This wasn't even stress eating or anything, I just genuinely needed the energy because you know, I was a teenager and my body was developing. I feel like so many teenage girls think they need to eat as little as possible to be petite and pretty, but the truth is that your body is developing just as intensely as teenage boys' bodies. Eat more, please, your body needs it.