[kosmogrl]

[nonamehorse]

[magicalgirlmindcrank]

god I love the meme of putting "u know how it is with spaghetti" under pictures of blood/gore but i feel it almost does a disservice to the original

[flagellant]

kill the shift manager in your brain

[flagellant]

you are not wasting time you are vibing. you are not being unproductive you are literally chilling. make a grill cheese with cheddar cheese and slather a piece of the bread with some honey and maybe you'll relax

[greelin]

pros of putting laundry away immediately after it is dry

less wrinkles

yayyyy organization

it is done

cons

right now you have to do it. Right fucking now. nightmare world hell on earth torture realm pain and suffering and carnage

[cowboy]

What would happen if you got an email

[starjasmines]

i would check it

[cowboy]

You sick fuck.

[mandronia]

[thatoneblog89-deactivated202406]

Me walking into work

[asticot]

[fortuham]

[the-cinder-fields]

Victor Nizovtsev, Promise, c 2010

[veryluckyclovers]

[metamorphesque]

— Haruki Murakami, Norwegian Wood

[dtf-collages-deactivated2023072]

An over 400 million year old, unproblematic dynasty

[hjarta-deactivated20260124]

i am going to dedicate my life to mastering the art of making the people around me feel seen and loved

[papasmoke]

Please list your full genome sequence in your bio

[papasmoke]

Louis | 24 | Bi | They/Them | GATTACATACCTTACTTATTACCGATAGGGCAGATTACGGACCTATTAGATTACATAGATAGGGGAAAAAACATAGATACATACGTAGTTGCTCGACACTAGATTACAGATACTAATATTTTGATACCCAGGTTAGACGATTACAGATTACATTACAGGATACCGATGAGGATAGGACGATTACATACCTTACTTATTACCGATAGGGCAGATTACGGACCTATTAGATTACATAGATAGGGGAAAAAACATAGATACATACGTAGATTACATTAGACCATAGGTTGCTCGACACTAGATTACAGATACTAATATTTTGATACCCAGGTTAGACGATTACAGATTACATTACAGGATACCGATGAGGATAGGA | White

[papasmoke]

People are telling me that this genome sequence is "too short" and "doesn't match any known organism" and if my genome looked like that i would be "dead" but maybe those people simply haven't optimized their genomes like I have

[cikero]

I be sleeping in the master chief position

[cikero]

[crtter]

[freedominthedarkmp3]

I miss when library books used to have little paper pockets inside with a list of all the people who borrowed it and when... I hate that this is now exclusive knowledge of librarians. I do care that a miss Mariana borrowed this book in 1985 and then Dario in 1997. They're my brothers and sisters

[spaceswordblaster]

So apparently in the US this is a thing librarians started doing so that they never have to report people for checking out books due to bullshit Patriot Act reasons 🙄

[valtsv]

had to stop playing 5d chess with multiverse time travel because my knights fell in love and kept going back in time to save each other in every timeline and creating paradoxical time loops and it was just this whole thing