star @nocherryblood - Tumblr Blog

radiolightning

In case anyone is having a bad night:

Here is the fudgiest brownie in a mug recipe I’ve found

Here are some fun sites

Here is a master post of Adventure Time episodes and comics

Here is a master post of movies including Disney and Studio Ghibli

Here is a master post of other master posts to TV shows and movies

*tucks you in with fuzzy blanket* *pats your head*

You’ll be okay, friend <3

meanwolfs-remade-deactivated201

i will reblog this everytime it shows up because any of my followers could have a bad night right now

becausewhatiam-iswhatimnot

All these links, besides the first, are broken. So here’s some more.

Here’s an emergency compliment

Here you can play 2048

Here’s a playlist of Bob ross

Here’s a website to watch movie’s and shows for free

Here’s a website to watch documentaries for free

Here you can to nothing for two minutes

Here you can break something. It’s good for anger

Here’s a button to press to make everything okay

Here’s a site to cut something up (TRIGGER WARNING)

Here’s a site that makes you a website depending on a song you choose

Here’s a gay comic. It’s adorable

Here you can spend Bill Gate’s money

Here you can draw your own island

Here you can learn about patterns website’s use

Here you can get your life stats

Here you can listen to the Tucker Zone (Headphones needed)

Here you can see how fast you’re moving

Here you can see the progress of time

Here you can see the future of the universe

becausewhatiam-iswhatimnot

Want some more?

Here’s the butterfly project

Here’s a snickerdoodle mug cake

Here’s a link to some free audiobooks

Here’s something to read when you feel like a burden

Here’s a secret

Here’s my playlist of some sea shanties

Here’s another secret

Here’s a link to some cool websites

Here’s a blog that gives you recipes for when you’re low on spoons

Here’s some Brony Headcanon’s

becausewhatiam-iswhatimnot

Some more? I’ve got plenty

Here’s 100,000 stars

Here you can control the weather (TW FLASHING IMAGES)

Here you can weave silk

Here you can make a castle of your own

Here you can make a kaleidoscope drawing

Here you can explore recursion

Here you can play a jelly block game

becausewhatiam-iswhatimnot

I’m back with some more!

Here you can draw with pasta

Here you can draw logo’s from memory

Here you can play this is sand, here you draw cool sand designs

Here you can play The Organ Trail

Here’s a customizable white noise website

Here you can simulate gravity

Here you can create your own guardian of the galaxy

Here you can make your own galaxy

Here’s a website you can get some support at.

becausewhatiam-iswhatimnot

to find later

addiewho

Here you can split circles into smaller and smaller pieces (I found this really satisfying)

Here you can have images of people point to where your pointer is

Here you can paint someone’s nails

Here you can grow a garden across your screen (Audio included)

Here you can try out all kinds of mind illusions (Trigger Warning: Flashing Lights)

Here you can see how many miles you have scrolled

Here you can watch a website load forever, although you might be getting enough of this on Tumblr mobile

Here’s a rickroll

Here you can remind yourself that you’re awesome.

Here you can throw trash into a dustbin only for it to bounce right back out (Audio included)

Here you can make sand dunes using sand (Audio included)

And here you can generate more cool websites like these

boy-in-the-stars

pinning thissss

fiddlepickdouglas

And yet more!!!

Here you can listen to a gentle rainstorm

Here you can make snowflakes

Here is a Line Rider feature film with relaxing music

Here is the entire script to the Princess Bride (many don’t need it but it’s fun to read anyway)

Here is an abbreviated script for the entirety of Book 1 of A:TLA that I made out of anger at the film that definitely doesn’t exist

Here is a playlist of the top 10 most relaxing songs ranked according to science

Here’s a site where you can make a dude beatbox with fun animations

nyxsomnia7

I’m fully aware I will need this at some point.

#save #try

ceaseless-sandwich

As my mental health spirals. I have been handling it by binge watching Noel's house party. So here is my full ramble on it I Hope you enjoy!

FLASH WARNING FOR SOME GIF'S

Noel's house party

Noel's house party is a live variety show that was aired live BBC one from 1991 to 1999 hosted by Noel Edmonds at the time around 43 years old.

The show had multiple segments which encouraged audience participation through phone calls.

The show mainly focused on British celebrities mainly associated with the BBC at the time basically if you were in the UK and you were famous, you were not safe at this time lol.

In each episode there are regular segments that do change depending on the season but here are some of my favorites not all will be covered if you want that thear is the Wikipedia

ceaseless-sandwich

This is part 2 to this!

Back to the blob!

The horrific amounts of merchandise with absolutely no quality assurance is the exact reason why I want to collect it

#holy damn this is so in depth #wait this is Tumblr I can SWEAR 🥹#holy shit I love it #i too also want blobby merch #think I got a blobby badge a year or two back #i want more #the quality assurance being non existent is yes absolutely the best part

Yo!

I'm Cristar and I'm reviving this blog since last host flew, like a very unfortunate moth, a little too close to the lightbulb. Damn they had so much on here 😔

21

OSDD

Main posters are me, Shadds 🖤, Fang (idk what emoji it uses), Michael 🌀, Bill ⚠️👁️, and Star ✨

#intro #system #see I thought I was done with tumblr until I noticed myself using tiktok tags like tumblr #knew it was time to return

cecils-house-party

Who let this man leave the house like this

Something I love is all of Noel's lovingly ugly outfits.

dinomoder

This is the best ad for Project Hail Mary I have ever seen. Like if I was on the fence about watching or reading it, this would convince me to do so.

gay-mooshrooms

ask-the-fishdick-deactivated201

REBLOG IF IT IS OKAY TO COME INTO YOUR INBOX AND SAY THE RANDOMEST SHIT I CAN THINK OF BECAUSE I REALLY WANT TO INTERACT WITH YOU.

wordfather

all i want is to get hellsitegeneticsed. i want to know what kind of creature my post is. god i want it to be something cool sooooooooo bad do you think they have the genetic code for werewolves

hellsitegenetics

String identified: aattgttgtcattatcattgattttgcattatgtcc

Closest match: fucking badass werewolf Common name: hell yeahhhh

wordfather

so this is what it's like to be god's favorite

hellsitegenetics

I’m obsessed with your entire blog premise and so curious about your backstory. were you a geneticist denied funding so you went rogue and now you’re collecting all genome sequences to enact revenge? are you perhaps a scientist from the Jurassic park universe making sure none of your secret dinosaur dna sequences escape containment? are you italian

String identified: ’ t t g a c at act. a gtct g t g a ’ cctg a g c t act g? a a a ctt t ac a ag ct a a c ca ctat? a taa

Closest match: Capsicum rhomboideum cultivar Andean isolate CrT2T chromosome 3

inverse-galatea

what's your backstory

geneticist denied funding who went rogue

scientist from the jurassic park universe

italian

secret 4th option

Voting ended onFeb 22, 2024

hellsitegenetics

democracy has spoken apparently i am italian

pixieddusterr

back with some more fanartttt

gothicdruidstryix

June’s almost over lads and lassies, so a late happy Pride Month to all! I really wanted to do art for it but I couldn’t figure it out :(. Hope y’alls doing well wherever you are! - a Pan/Omni/Asexual Nonbinary/Genderfluid Therian on the internet :3

Since it's been like three years since I've been on this app... wanna see my updated art?

#art #update #my god it's been that long