Love Begins
Alisa U Zemlji Chuda
ojovivo
$LAYYYTER
h
I'd rather be in outer space 🛸
todays bird
Claire Keane
KIROKAZE
JVL
No title available
No title available
almost home
wallacepolsom
YOU ARE THE REASON
hello vonnie
#extradirty
No title available
Aqua Utopia｜海の底で記憶を紡ぐ
No title available
seen from United States
seen from United States
seen from United States
seen from Poland
seen from Australia
seen from Netherlands
seen from Netherlands
seen from United States
seen from Portugal
seen from Malaysia
seen from United States
seen from Ukraine
seen from United States
seen from India
seen from Indonesia
seen from Malaysia
seen from United States
seen from Ecuador
seen from United States
seen from United States
@sirdannir
Hi brain, you obstinate fucker. I drank the clear splashy stuff. I ate the green things. I went under that bright fucker up there. I did the thing with the moving and sweating and whatnot. Now make the happy chemical, you lump of fuck.
did you do the thing with lying unconscious for 8 hours
……… fuck.
:) More Behind the GIFs.
so that post about how you can get around the bot by tagging things “#sfw”? uhhhhh it’s TRUE.
i did a little test in my drafts:
i am losing my goddamn mind like how is it possible to be this stupid
Fucking hell?!?!!??
[source]
FREE HIM
HE CAME BACK
Everything about this is so fucking funny. The song. The chubby dances. The way he just gets fucking KIDNAPPED. The presentation of the guy in the white shirt in the picture when he returns. This is my favorite post.
Are straight white people okay????
What is this?!
People like this exist. Interesting.
this story has a part 2
THERE IS A PART 3 WITH GUEST RESPONSES I REPEAT THERE IS A PART 3 THIS IS NOT A DRILL
I thought things couldn’t get more horrifyingly amusing than the woman who wanted people to pay $1000 each to go to her wedding so she could “feel like a Kardashian for a day” and had a Facebook breakdown about it saying she was gonna go backpacking in Peru to “find herself” after being “betrayed” by her friends who didn’t want to partake but here we are
I thought it was the same person ngl.
I’m in the wedding shaming group and saw both this and the Peru post before it went viral. Love it.
THERE’S AN UPDATE
Stephanie is a true hero.
my favorite thing about this update is that the fact that we are even SEEING this means there’s AT LEAST one other snitch in the party that she hasn’t caught yet
My condolences to the groom.
Did everyone just…. forget how to create, all of a sudden? Disney pumping out the fourth remake in a row? Movies are like 70% sequels? Stories in games being just bad if they exist at all? Haven’t had a book get hyped in like half a decade? Are we okay? What’s going on?
Right now, the largest and most deadly wildfire in California history is burning. Last year, Hurricane Harvey drowned southeast Texas under punishing, endless rain; a month ago, Hurricane Florence …
The myth that panic, looting, and antisocial behavior increases during the apocalypse (or apocalyptic-like scenarios) is in fact a myth—and has been solidly disproved by multiple scientific studies. The National Earthquake Hazards Reduction Program, a research group within the United States Federal Emergency Management Administration (FEMA), has produced research that shows over and over again that “disaster victims are assisted first by others in the immediate vicinity and surrounding area and only later by official public safety personnel […] The spontaneous provision of assistance is facilitated by the fact that when crises occur, they take place in the context of ongoing community life and daily routines—that is, they affect not isolated individuals but rather people who are embedded in networks of social relationships.” (Facing Hazards and Disasters: Understanding Human Dimensions, National Academy of Sciences, 2006). Humans do not, under the pressure of an emergency, socially collapse. Rather, they seem to display higher levels of social cohesion, despite what media or government agents might expect…or portray on TV. Humans, after the apocalypse, band together in collectives to help one another—and they do this spontaneously. Disaster response workers call it ‘spontaneous prosocial helping behavior’, and it saves lives.
I’ve been sharing this article a lot recently! I think it’s important
#stop believing capitalism’s myths about human nature#and start remembering that we are the descendants of the first animals to bury their dead with flowers#we are all alive because of kindness. because of cooperation. because of companionship. because of mutual aid.#we did not become the dominant species based on rugged individualism: we survived together. and that’s the only way forward. (via @robotmango)
The Thief
The Jester
The Fool
The King
Sneaky sneak~
Marinette getting in the December mood
what th
I’VE BEEN TRYING TO find this again for THREE YEARS but once Free! came out I couldn’t google ANIME SWIMMING CLIP ANYMORE
This is such a god damn amazing piece of animation
Oh myfdb c
Incase anything happens to my account here’s my entire genome:
GATTTACTCGTACGGTACGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGYTTCCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATTAOCGGTACGATCCCGTAGGGTAGGGGGTTAATTGGCTCTGAGGGTTCTYCTCAATCCTCAATCAATCCTCHUATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGAATTCCAATCAATCCTCAATCATCAATCAACTCKAATCAATCCTCHATCTNACCCCCTTTAFCOGATCCCGTAGGGTAGGATCCTCATCTACCCTTCCTTTAFCGATCCCGTAGWGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTGATTTACTCGTACGGTACGATCCCGTAGGGTAGGGGGTTAAGGCTCTGIAGGGTTCCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGHCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATTACGGTACGATCCCGTAGGGTAGGGGGTTAATTGGCTCTGAGGGTTCTYCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCACGTAGGGTAGGGGGTTAAGGCTCTGAGGGAATTCCAATCAATCCTCAATCATCAATCAACTDCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCATCTACCCTTCCTTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTCATCTACCCCCTTTAFCGATOCCCGTAGGGTAGHGCCTCAATCATCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCHATCTACCCCCTTTAFCGATCCCGDTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCATCTACCCCCTTTAFOCGATCCCGTAGGGTAGHGCCTCAATCATCAATCCTCAATCCTTTAFCGATCCCGTAGGGTIAGGATCCTCATCTACCTCTTCCTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAOATCCTCTCAATCCTCAATCAATCCTCATCTACCCCCTTTAFCGATCCCGTAGGGTAGHGCCTCAATCATCAATCCETCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCATCTACCCCCTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTMTCCAATCAATCCTCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGG…
You got like six unique nucleotides so nice
OP is a virus from outer space
FUCK YOU OP
I’m a simple man
The Sugar Plum Fairy
