Today's Document
TVSTRANGERTHINGS
Cosmic Funnies
Misplaced Lens Cap
Product Placement
"I'm Dorothy Gale from Kansas"
❣ Chile in a Photography ❣
tumblr dot com
h
todays bird
NASA
untitled
Claire Keane
Xuebing Du
izzy's playlists!
Lint Roller? I Barely Know Her
will byers stan first human second
Cosimo Galluzzi
Fai_Ryy
★
seen from Malaysia
seen from United States
seen from United States
seen from United States
seen from Canada
seen from Japan
seen from Algeria
seen from Türkiye
seen from United States
seen from India
seen from Malaysia
seen from Brazil
seen from South Korea
seen from Belgium
seen from Italy
seen from United States
seen from Malaysia
seen from Japan
seen from Australia
seen from Italy
@mint-and-parsley
the adhd urge to exhaustively organize and catalog things vs. the adhd immediate forgetting of where you put literally everything
my embroidery floss collection is impeccable but i left my earbuds in the kitchen last night and couldn't find them
My different kinds of rice are arranged in a color gradient but there is shredded cheese in my coat pocket
Please list your full genome sequence in your bio
Louis | 24 | Bi | They/Them | GATTACATACCTTACTTATTACCGATAGGGCAGATTACGGACCTATTAGATTACATAGATAGGGGAAAAAACATAGATACATACGTAGTTGCTCGACACTAGATTACAGATACTAATATTTTGATACCCAGGTTAGACGATTACAGATTACATTACAGGATACCGATGAGGATAGGACGATTACATACCTTACTTATTACCGATAGGGCAGATTACGGACCTATTAGATTACATAGATAGGGGAAAAAACATAGATACATACGTAGATTACATTAGACCATAGGTTGCTCGACACTAGATTACAGATACTAATATTTTGATACCCAGGTTAGACGATTACAGATTACATTACAGGATACCGATGAGGATAGGA | White
People are telling me that this genome sequence is "too short" and "doesn't match any known organism" and if my genome looked like that i would be "dead" but maybe those people simply haven't optimized their genomes like I have
workplaces: we encourage people of all abilities to apply!! :)
the same workplaces: *must be able to lift 20-50 lbs unassisted for this random desk job* *must be able to kneel, bend, and stand for extended periods of time for this research position* *must be able to walk (yes I’ve literally seen this exact wording on job applications before)*
oh my.
this is so perfect.
(source)
Hollywood archaeology: Secret treasure! Hidden maps! Ancient tombs!
Actual archaeology:
so I wanted to find a picture of the lobster and
behold! an archaeologist
https://youtu.be/nUwM16FaEZU
Looks like 2021 is really out here trying to make up for 2020 with potential proof of a family of live thylacines caught in photos. According to the video, he’s awaiting basically one last expert to weigh in, but the others have apparently all agreed…. A mom, dad, and their baby.
I’ll get a transcript up in a few minutes but I’m so excited to hear this!
[Video transcript
[Video begins with words over the striped part of a thylacine pelt. The words read “Thylacine Awareness Group of Australia” on a red banner. It switches to the face of a bearded man with an accent talking as he walks across farmland. He is the sole speaker for the entire video (but I’m breaking up his speech to make it easier to read with eyes)]
Man: Good evening everybody. This is um… uh Me, coming to you live from northeast Tazzy, from some little town that grows a bit of hops for all the beer. So. The last 10 days I’ve probably been acting a bit weird to everybody in the group and online and uh that’s because uhm. Y’know I was checking the SD cards, I found some photos that were pretty damn good.
I know what they are. And so do a few independent witnesses, expert uh canine judges, feline judges, and a vet so far have seen it. I’ve left the… the images with Nick Mooney from uhm the museum. He’s an honorary to the museum in Hobart [???? teamek maybe?]. He’s having a look at them and uh…
I can tell you there’s 3 animals. We believe that uh- when I say we, I mean myself and the committee of TAGA - believe that the first image is the mum, we know the second image is the baby, because it’s so tiny, and third image is the dad. And there’s a little bit of a clue with the mom and the dad as to what they are, certain features of them, ah, but they are ambiguous. HOWEVER. The baby is not ambiguous. The baby has stripes, a stiff tail, the [’hawk/hock?], the coarse hair, it’s the right color, it’s a quadruped. Stocky. And it’s got the right shaped ears. So, looking at the baby, not only do we have a family walking through the bush, we have proof of breeding. So, it puts our thylacine in a much stronger position than it’s been in for the last 30 something years now. 35 I believe.
So, we wait and see. We get confirmation or rejection from Nick Mooney. Either way, um, the museum’s had the first chance to look at the photos. I’ve done the right thing and given the experts a chance to have a look and tell me what they think. Soon, we will know. Hopefully by the end of the week, but it may take a bit longer, and we’ll plan our strategy around that um and hopefully be able to work with the museum and go forward in having the animal reclassified as critically endangered. OR ENDANGERED. We don’t know. We don’t know how many are there, but we know there’s at least 3 wandering around northeast Tasmania with the intention of continuing to do so.
So. Congratulations everyone. [he holds up the beer can he’s been carrying} We’ve done it. Cheers.
[The initial image of thylacine stripes overlaid by the Thylacine Awareness Group of Australia appears]
End transcript]
OH MY GOD I JUST SAW THIS ON TIKTOK AND I AM DYING
I thought this was a really good impression but it's actually the original voice actor!!
@transhostilefox
Risu just sent me this and I am SO DELIGHTED
Archeologists say they have found the world's oldest piece of yarn or cord, making it the earliest known evidence of textile and cord making
Ahhhhhhh!!! Go read it! Go read it!! The cording was plied by Neanderthals!!! The article talks about how we can’t keep thinking about them as being stupid it’s so delightful! In these trying times, let’s read about some joyful anthropological and archaeological discoveries!!!
Read it! The fact that it’s plied is so exciting! For plied cord, you first spin your fibers in one direction (they did it clockwise) and then take that collection of singles and twist them in the opposite direction (in this case counterclockwise). So it’s a process that requires planning and experience. You spin your first bit, you set it aside, you spin your second and third, you ply them. You can’t do it all in one go. And unless this piece happens to be the work of the very first person to spin fibers, and that person was a super genius who not only invented the idea of spinning but the technique for plying, it shows that the Neanderthals were communicating technological skills amongst each other. Which I mean isn’t news in and of itself, but this is just one more piece of evidence.
FERAL FROTHING IN FIBER ARTS THIS SHIT IS SO COOL
I CAN’T MAKE THIS SHIT UP
t-shirt that says "i rely on pharmaceutical drugs to preform routine tasks"
YOOOOOOO 😦
Whoever had “Dyatlov Pass Incident Solved Using Frozen” on their Bingo card...
Here’s a NatGeo article for more reading!
This is obviously about Phasmophobia but I actually prefer it with no context
EXCUSE ME ?!?!?!?
"Nickelback doing sea shanties on tiktok" wasn't on my wishlist but now that it's here I wonder why I didn't ask for it
i don’t think i’ve made a personal post on this blog in 84 years, but i started ds9 and garashir is going to be the end of me. someone drop by my inbox and humor me as i cry about a wannabe james bond of a doctor and a fashionable sad lizard.
Current diagnostic criteria for autism excludes children who have been raised in supportive and accepting environments, making them undiagnosable.
“That’s right…. my son’s paediatrician says that my autistic way of parenting supports my son too well for him to be traumatised enough for a diagnosis, so we should let school traumatise him and come back later…
…Which brings me to thinking about how we identify autism in the children who are now being raised by autistic parents in a respectful and supportive way. The children who have experienced acceptance of their autistic neurology from birth and who have never been exposed to harmful therapies.
Autistic children raised by accepting parents, often autistic themselves.”
It’s true. The current clinical model for Autism is based on traumatized Autistic children. The experiences of happy, well-nurtured, thriving Autistic people have been hugely excluded from the clinical literature. That needs to change.
on the converse i got undiagnosed by a misogynistic psychologist because the specific ways i was traumatized (especially as a girl) led to me constantly masking to the point where he said i outwardly didn’t seem autistic enough for him to think i counted as autistic, despite my brother there to put in word for how i used to be and despite me saying the amount of constant effort i put in to masking my autistic traits in everyday life leads me to periodic breakdowns, to which he took no concern and dismissed it as me being irrational and exaggerating my struggle, despite only meeting me 4 hours earlier.
the fact that both of these experiences are common goes to show that the mental health field under capitalism neither cares about ameliorating people’s suffering nor genuinely creating a world inclusive of neurodiversity
for me and for many in the community, the label “autistic” is a convenient shorthand for certain patterns/commonalities in the way we/our brains function, and can give us space to communicate with others like us about what that means for our experiences in our current society
for them, it is a way to pathologize certain outwardly exhibiting traits that are seen as a burden or a drag on resources or that are seen as refusal to neatly integrate into structures capitalism uses to perpetuate itself. so whatever people’s needs are, they’ll be happy to switch between denying agency and denying need for help/resources whenever is most convenient
It’s because neurodivergence means nothing to neurotypical society, outside of how it affects them.
I’ve asked this question before:
What do you call an autistic that meets every single criteria except the whole, “it interferes with their life,” thing because they manage to cope well enough to get by?
In someone who is already diagnosed, we call them autistic. In someone who hasn’t been diagnosed, we call them subclinical.
But if we recognize that learning the skills for coping after diagnosis still means a person is a life long autistic, how come we don’t recognize this same thing in autistics who figure it out before they are diagnosed autistic?
This is literally the reason it is so very hard to get a diagnosis as an adult. A lot of the times we do have enough coping skills to get by, even if we don’t understand what those coping skills are being used for.
The entire premise of autism as it is understood by the broader medical community is that if you are autistic, it is impossible for you to learn to cope with the world and that’s how you know you are autistic, then turning around and saying, “Here’s how you cope with autism,” after you are diagnosed.
This is 1.) why anyone who says clinical diagnosis is required or the only real diagnosis needs to just eff right off and 2.) why a strictly medical model is a shit idea, and 3.) why we absolutely neeeeeeeeed to listen to late diagnosed adults about their experiences and 4,) fix gaps in clinical diagnosis for people who want or need it.
At the end of the day, the answer to, “What do you call an autistic who can cope,” needs to be, “autistic,” full stop.
Take me down to Paradise City, where the grass is green and the girls be pretty, didn’t make sense not to live for fun, your brain gets smart but your ass gets dumb ooO I’ve! Become so numb! I can feel you there!
You’ve exactly captured the way my brain processes songs.
