I think I have a life but I'm not sure...

Finland, 20s, she/her, can and will reblog anything i find interesting

[the-big-mood]

Pokémon playing hide and seek is the cutest thing ever🥺

[talesfromtreatment]

Sir, your spleen a- should not be this large, b- should be that far down your body, and c- why the fuck is your spleen on the right side of your body why is it there it doesn't belong there put it back

[talesfromtreatment]

*currently looking up words that rhyme with spleen*

[talesfromtreatment]

Your spleen, your spleen, your spleen, your spleen Oh, I'm begging of you please don't be that size your spleen, your spleen, your spleen, your spleen Please don't be over on the right side

The size it is beyond compare It shouldn't be way over there Put it back right now, oh god, your spleen

The vets have never seen its like you truly gave them quite the fright We don't know what do with it, your spleen

Your guts aren't mirrored there it's true But we also haven't got a clue Why it's hanging with your bladder, oh, your spleen

Did you torse it 'round somehow? Is cancer forming there right now? What you have done's a mystery, your spleen, your spleen

Your spleen, your spleen, your spleen, your spleen Oh, I'm begging of you please don't be that size your spleen, your spleen, your spleen, your spleen Please don't be over on the right side

We've asked the radiologist to see if there's something we missed We need to know so much about your spleen

Why is your body built this way It's going to haunt me night and day 'Cause it's the only one I've seen, your spleen, your spleen

Your spleen, your spleen, your spleen, your spleen Oh, I'm begging of you please don't be that size your spleen, your spleen, your spleen, your spleen Please don't be over on the right side your spleen, your spleen

[zetrystan]

Technically true.

[zetrystan]

He got the job.

[zetrystan]

He takes his job seriously.

[zetrystan]

Prof Rad over on youtube dubbed the Wolf Hunter comic (click here)! 

Go check it out and give them some support! :) (also the end killed me haha) ₍ᐢ•ﻌ•ᐢ₎

[zetrystan]

The farmer sheared the sheep, and it was used to make a gift for Wolf Hunter, so…

[zetrystan]

Wolf Hunter goes to the village markets.

[zetrystan]

Wolf Hunter and his conga line of sheep.

[zetrystan]

Wolf Hunter was looking for them for a while.

[zetrystan]

Not a werewolf.

[zetrystan]

The disappearance. 🐑

[zetrystan]

The worst snowman.

[phyllidaluna]

Bug Boys and their weird dogs

[kausijuoppo]

<<previous

read from the beginning

Read 'Your Son Has Never Felt More Alive' on Tapas or Webtoons

[cute-animals-only]

[supreme-leader-stoat]

[visenyaism]

top five worst ways to be found:

5. out

4. guilty

3. wanting

2. lacking

1. by this email

[visenyaism]

It has come to my attention that I forgot about dead

[evelynmoore-art-deactivated2025]

Beautiful sunset oil on canvas painting available for purchase ✨️ 😊

[arrowheadedbitch]

The wine dark sea.

[marillenzeug]

Jolteon!

Not happy with the style yet, but it’s going somewhere

[hellsitegenetics]

I found this wet floor sign with some suspiciously dna looking writing on it

String identified: CAT CA TAGCT T A t t g t c a g tg t

Closest match: Sphaeramia orbicularis genome assembly, chromosome: 4 Common name: Chubby Cardinal

(image source)

[hellsitegenetics]

[wordfather]

all i want is to get hellsitegeneticsed. i want to know what kind of creature my post is. god i want it to be something cool sooooooooo bad do you think they have the genetic code for werewolves

[hellsitegenetics]

String identified: aattgttgtcattatcattgattttgcattatgtcc

Closest match: fucking badass werewolf Common name: hell yeahhhh

[wordfather]

so this is what it's like to be god's favorite

[cute-pluto]

ive just been born into the world what are some good games for beginners

[rendogdomesticated]

this one won goty five yrs in a row and i heard its got awesome ratings

[chongoblog]

Tier List

S Tier: Green Line - High up and long circular motions are the sauce. Absolute banger.

A Tier: Blue Line - Nothing special in terms of line structure, but the texture on the beads are what make this one so great

B Tier: Yellow Line - The Right Angled motions are honestly mesmerizing

C Tier: Orange Line - The Vertical Up and Down motions can be fun but it just comes across as clunky

F Tier: Red Line - What are you even doing

[bananonbinary]

are you fucking kidding me the red line beads are a FAR more compelling texture than the blue line. “oh but the red line is booring.” the appeal is in how it interacts with and highlights the other lines you philistine. without the red line there’s no cohesion at all. read a book.

[nfirr]

Literally hop off. Red doesn’t even use gravity as an element in the main route. Orange is one of the only three lines (with green and yellow) to actually use gravity to add complexity to the route, and is honestly an underrated pick. Have fun playing “push left” simulator with red. Idiot.

[felidthing]

via @wrenrouge

[hellsitegenetics]

String identified: t t t at a g ga g t gt a a a t gt a atg T t T: G - g a g cca t a t ac. At ag. A T: - tg ca t tct, t t tt t a a at a t gat T: - T gt Ag t a t g C T: ag - T tca a t ca t t t c ac a c T: - at a g a cg g t a a a A cg tt ta t . “ t t g.” t aa t tact t a ggt t t t. tt t t’ c at a. a a . ta . ’t gat a a t t a t. ag t t (t g a ) t acta gat t a ct t t t, a t a at c. a ag “ t” at t . t. tg atg t atca atg

Closest match: Citrullus ecirrhosus cultivar PI 673135 chromosome 11 Common name: Namib tsamma

(image source)

[ghostlygunk]

[hyperions-fate]

No tech CEO or NYT bestselling novelist will ever match the creativity of a humble French postman who decided on a whim to spend thirty-three years building a surreal, majestic palace with the bricks and mortar of his dreams.

[hyperions-fate]

[wlwillow]

[eek-a-tron]

Couple of interesting additions:

1. Ferdinand Cheval tripped over a stone and was inspired by its shape, eventually stating, "It represents a sculpture so strange that it is impossible for man to imitate, it represents any kind of animal, any kind of caricature. I said to myself: since Nature is willing to do the sculpture, I will do the masonry and the architecture."

Here's the tripped-over sandstone in question, which explains some of the abstract design:

Oh, and also:

2. He tripped and started this when he was 43.

[constarlations]

Nemona, 0.1 seconds upon finding out about the Z-A Battle Royale

[everydaylouie]

jeepeon (based on this image from Let's Find Pokemon)

[reallyreallyreallytrying]

“average person eats 3 spiders a year” factoid actualy just statistical error. average person eats 0 spiders per year. Spiders Georg, who lives in cave & eats over 10,000 each day, is an outlier adn should not have been counted

[laerugo]

#tapping the reblog button with utmost care because i’m handling a historical artifact (via @malarkiness)

[mortimermcmirestinks]

holy shit OP is not only still active but is still making absolutely banger posts in this exact style 11 years later

[rue-nightly]

A 2025 update

[viejospellejos]

Satisfactorio

[yeoldbarback]