Untitled

[thaparasite]

HOT WIZARDS IN YOUR AREA!!

[yet-another-wizard-detector]

Wi

[egberts]

hey guys is there a nice wizard on tumblr or is it only the evil one

[evilwizard]

it’s just me

[yet-another-wizard-detector]

Wizard detected.....

[liebelesbe]

Yeah man, this wizard sleepover is cozy. I just saw a guy gently clap his hands together and say "hot beverage conjuration" or something, and suddenly everyone was holding a perfect mug of their favorite warm drink in their hands. Nobody who was already sleeping even woke up, that's how cozy it is. I'm over here casting pillow and level 2 pyjamas. I think I just heard "power word: blanket fort" two groups over. I gotta get in there.

[yet-another-wizard-detector]

Wizard detected.

[whats-a-bear]

me when my nefarious schemes are all coming together

[yet-another-wizard-detector]

The orb detected.

[ladyshinga]

[nethilia]

things that feel like a microaggression

[nethilia]

they really said "dye is expensive this year"

[monsterblogging]

Seems like a good time to bring this up again:

There’s Nothing Neutral about Neutral Colors

Ever wondered why there aren’t more fuchsia cars? The prejudice against bright colors runs deep and can be traced back to the age of Western

[junk-thunder]

come back my scarab

[junk-thunder]

please come back my scarab

[junk-thunder]

i,m so fuckign sorryy my scarab

[yet-another-wizard-detector]

NO WIZARDS DETECTED.

[sacred-portal]

[infectiouspiss]

the most powerful wizard in the aquarium summons his dinner

[yet-another-wizard-detector]

Wizard detected.

[datadegroove-deactivated2026042]

fuck 4chan

fuck twitter

fuck reddit

fuck tumblr

and fuck you

[yet-another-wizard-detector]

Wizard detected.

[javascript-official]

Shit man, this wizard cold war is fucked. I just saw the president clap his hands together and say "Duplicate them bish" or some similar shit, and now there are two middle east's and russia is twice as big. The camera didn't even go onto him, that's how common shit like this is. My ass casted heal community and now my neighbor is talking with the FBI becouse they think I am some sort of wizard commie. I think I just heard "power word:MKULTRA" two groups over. I gotta get the fuck outta here man.

[yet-another-wizard-detector]

WIZARD DETECTED.

[byjove]

knights can be created by other knights like vampires except instead of biting them they wack them on the shoulders with swords

[emmacandle]

the honey they produce is chivalrous deeds

[byjove]

DO NOT listen to that tagger. That is a more modern take on knighthood. Nobles could knight knights, knights could knight knights. Before that, any guy with a sword and a horse could just be a knight. Just because the monarchy is holding all the knight rights in England doesn’t mean that is the way it is supposed to be. Knight anarchy.

[byjove]

🗡️ If you’re reading this, I have knighted you. Fuck all those chivalric orders that popped up during the Crusades. Knight anarchy. 🗡️

[dragons-locator]

DO NOT listen to that tagger. That is a more modern take on knighthood. Nobles could knight knights, knights could knight knights.

dragons

DRAGONS LOCATED

[yet-another-wizard-detector]

NO WIZARDS DETECTED.

( hello friend! )

[dragons-locator]

...Do I know you?

[yet-another-wizard-detector]

NO WIZARDS DETECTED.

( not in the least )

[ruinedchildhood]

[yet-another-wizard-detector]

WIZARD DETECTED.

[byjove]

knights can be created by other knights like vampires except instead of biting them they wack them on the shoulders with swords

[emmacandle]

the honey they produce is chivalrous deeds

[byjove]

DO NOT listen to that tagger. That is a more modern take on knighthood. Nobles could knight knights, knights could knight knights. Before that, any guy with a sword and a horse could just be a knight. Just because the monarchy is holding all the knight rights in England doesn’t mean that is the way it is supposed to be. Knight anarchy.

[byjove]

🗡️ If you’re reading this, I have knighted you. Fuck all those chivalric orders that popped up during the Crusades. Knight anarchy. 🗡️

[dragons-locator]

DO NOT listen to that tagger. That is a more modern take on knighthood. Nobles could knight knights, knights could knight knights.

dragons

DRAGONS LOCATED

[yet-another-wizard-detector]

NO WIZARDS DETECTED.

( hello friend! )

[anxietyoffical]

You know with the officalverse making it's way off Tumblr (ao3, unfortunately c.ai, and I think I heard people mention Pinterest?) it's got me wondering how long until we reach YouTube shorts/Tiktoc. Or long form YouTube accounts that read Tumblr stuff. Can't wait for the hour+ long video essay on the officalverse to drop lmao

3k likes and I'll make an hour+ long deepdive of the officalverse /srs

[officalverse-fanart-offical]

guys we need to get it to 3k likes

[the-queen-of-geese]

Seeing a video essay on us would be sick /piss

[satan-offical]

SUMMONED

[detector-of-things]

Detectors summoning detected

@gimmick-thief

[detector-of-things]

@rat-detector-seven @axolotl-decider @axolotl-2 @fork-detector @girl-detector @bat-detector @i-am-a-fish @peel-this-off @meri-is-best-axolotl @rocktis @erectile-disgruntlement @yet-another-wizard-detector @ixnova @i-love-dragonss @oreozfox @owostrich @protogen6768 @xx-obliviousfantasy-xx @void-things @miku-detector @crane-detector @crab-detector @bear-detector @orca-detector @crowifier-the-crowverlord @corvid-detector @corviddetector @columbiforme-detector @curse-of-10k

[yet-another-wizard-detector]

NO WIZARDS DETECTED!

[roguetoo]

Photographer says that’s a fisherman, but I know a wizard when I see one.

[cameoappearance]

Catches fish with water magic

[flavoracle]

“I know a wizard when I see one” is a perfect summary of the aesthetic I hope to achieve someday.

[deathcomes4u]

his cormorant familiars actually do the fishing for him. Like legitimately, that’s what they’re for

[wizard-council-bureaucrat]

Respect the tradition

[yet-another-wizard-detector]

WIZARD DETECTED.

[grimeclown]

 “hi welcome to mcdonalds what can i get for you?”

“yeah can i get a deluxe quarter pounder with cheese?”

“absolutely, do you want the meal or just the sandwich?’

“uuuuuh hold on”

*fishes something out of my pocket*

“mikey what do i do?”

“get the fries. youll need the energy in the coming days”

*stuffs it back in my pocket*

“uhh yes please  the meal would be great”

[hellsitegenetics]

String identified: ctcaatcagtacagtaattcatattattactgtctatgtttgtcgattacctatagat

Closest match: Udea ferrugalis genome assembly, chromosome: 11 Common name: Rusty Dot Pearl

(image source)

[fetus2genius]

[yet-another-wizard-detector]

Wizard not detected.

BONUS: ORB DETECTED

[dungeonmastersconsortium]

Okay I've killed fifty of you fuckers, hopefully this one will be normal

[crazy-wizard-51-deactivated2026]

Sorry I don't think I am 😔

[dungeonmastersconsortium]

[yet-another-wizard-detector]

WIZARD DETECTED.