i feel so bad for nikola tesla like imagine spending years beefing with a guy who has conned the public into believing he's some sort of supergenius when in reality it's his overworked employees developing all of his world-changing inventions and you end up dying broke and starving and alone and then 100 years later another guy cons the public into believing he's some sort of supergenius when in reality it's his overworked employees developing all of his world-changing inventions and he's doing it all IN YOUR NAME. he must be rolling in his grave like a fucking rotisserie chicken
I am grateful and deeply thankful that some of my family members who need urgent medical care made it out of Gaza before the situation in Rafah gets complex.
Hopefully we will start their medication and the necessary surgeries for them.
You saved some of my family members.
Remember even if you only payed 1 $ you were part of this noble saving for innocent souls.
My brother (Yahya), his wife (Wafa) and their daughter aged one year (Najat) are safe now because of your help.
For Yahya's eyes condition we still need your support whether by donating or sharing the campaign so he can get the medical care required. That were the good news.
The bad news is what you hear and see live on TV.
I am sad to tell you that Israel army invaded Rafah now. My other family members were displaced for 7th time!
I am sad that the innocent kids have to deal with all this horror by the frequent bombing around them.
PLEASE! Don’t stop sharing my campaign. You can be real part in saving innocent souls. Donate, share and talk about us.
The situation in Rafa is really hard and heartbreaking.
All I can do now is praying for my family who is still in Gaza.
And for others who made it out days ago; they need your support financially to cover their medication care and living expense.
Here are two pictures for Yahya and his daughter Najat who has a beautiful name meaning (Survival). These pictures were taken after they left Gaza days ago.
Dear friends and kind strangers,
I urgently need your support to … Eman Abuhayya needs your support for Evacuate My Family from Gaza for
…..not even six hours later i got an offer of a well paying full time long-term job with free room and board in queens in nyc, allowing me independence and a way to escape an abusive situation and an unhealthy environment
likes charge reblogs cast, folks, this is the good luck post
the last time I reblogged this post right before I got a great job, in a permanent work-from-home position, with benefits, retirement, and a salary literally 3x what I was making before, doing something I really like.
shinzo abe day was incredible. still not over seeing all the rumours about what happened, joining everyone in wondering how the fuck a shotgun assassination could have happened in japan, and then seeing the first photo of the doohickey
working in an office is just like being in a horse movie except the horse is a printer. im the only one in the office who can make it work and its because the printer and i have a special bond. its a wild and untamable spirit and we are going to win the big race
ok so for some reason i got 2 completely unrelated posts where the punchline is "nuclear blue". neither of them have any blogs in common that i can see. this is the other one. what is happening
This is a big deal. Elon Musk just fired everyone who can make life easier for people with disabilities, everyone who represents people with disabilities. The people who could save a someone's life.
Louis | 24 | Bi | They/Them | GATTACATACCTTACTTATTACCGATAGGGCAGATTACGGACCTATTAGATTACATAGATAGGGGAAAAAACATAGATACATACGTAGTTGCTCGACACTAGATTACAGATACTAATATTTTGATACCCAGGTTAGACGATTACAGATTACATTACAGGATACCGATGAGGATAGGACGATTACATACCTTACTTATTACCGATAGGGCAGATTACGGACCTATTAGATTACATAGATAGGGGAAAAAACATAGATACATACGTAGATTACATTAGACCATAGGTTGCTCGACACTAGATTACAGATACTAATATTTTGATACCCAGGTTAGACGATTACAGATTACATTACAGGATACCGATGAGGATAGGA | White
People are telling me that this genome sequence is "too short" and "doesn't match any known organism" and if my genome looked like that i would be "dead" but maybe those people simply haven't optimized their genomes like I have
scrolling twitter today and then coming over here is like walking out of a burning building and then walking into the calm remains of a building that burnt down 5 years ago and has been reclaimed by nature.
