This is a sideblog of @cyb0rg-crypt1d (introduction post is there)
My political sideblog is @cyb0rg-ec0
Misplaced Lens Cap
h
we're not kids anymore.
taylor price
2025 on Tumblr: Trends That Defined the Year
Not today Justin
Lint Roller? I Barely Know Her
will byers stan first human second
dirt enthusiast

Love Begins

@theartofmadeline
Aqua Utopia|海の底で記憶を紡ぐ

Origami Around

pixel skylines
Claire Keane

No title available
RMH
TVSTRANGERTHINGS

★
$LAYYYTER

seen from Bangladesh
seen from Bangladesh
seen from Bangladesh
seen from Oman
seen from United States
seen from United States
seen from United States

seen from United States
seen from United States

seen from United States
seen from United States

seen from United States
seen from United States
seen from United States
seen from United States

seen from Germany

seen from Malaysia

seen from Malaysia

seen from Italy

seen from Malaysia
@cyb0rg-sci
This is a sideblog of @cyb0rg-crypt1d (introduction post is there)
My political sideblog is @cyb0rg-ec0
I’m so mad that a t4 bacteriophage actually looks like that and that it’s appearance isn’t made up
this is how they look in all the models
this is how they actually look
like they really fucking look like that. in real life
viruses are literally such bullshit they have the nerve to look like this and they aren’t even ALIVE
I REFUSE TO ACCEPT THE SHITTY AND ARBITRARY DEFINITION OF LIFE THAT MAKES VIRUSES NOT ALIVE. FUCK YOU THEY ARE ALIVE
Things are heating up in the virus fandom
thats called a fever
what if a rat said cheesus christ
for the Spanish crowd: y si las ratas dijeran quesucristo
Happy Pesach wherever you are and however you sat it! Our unique cultural traditions are beautiful and worth celebrating!
Happy Passover!!
Posted on the noticeboard outside my uni lab.
String identified: aa a: ATGCGATATGCGCGATGCGATAGCGACAC, t gg a a tt a
Closest match: Agonopterix yeatiana genome assembly, chromosome: 15 Common name: Coastal Buff
(image source)
Fluent Forever's 625 must know words
in your target language
Animal: dog, cat, fish, bird, cow, pig, mouse, horse, wing, animal
Transportation: train, plane, car, truck, bicycle, bus, boat, ship, tire, gasoline, engine, (train) ticket, transportation
Location: city, house, apartment, street/road, airport, train station, bridge, hotel, restaurant, farm, court, school, office, room, town, university, club, bar, park, camp, store/shop, theater, library, hospital, church, market, country (USA, France, etc.), building, ground, space (outer space), bank, location
Clothing: hat, dress, suit, skirt, shirt, T-shirt, pants, shoes, pocket, coat, stain, clothing
Color: red, green, blue (light/dark), yellow, brown, pink, orange, black, white, gray, color
People: son, daughter, mother, father, parent (= mother/father), baby, man, woman, brother, sister, family, grandfather, grandmother, husband, wife, king, queen, president, neighbor, boy, girl, child (= boy/girl), adult (= man/woman), human (≠ animal), friend (Add a friend’s name), victim, player, fan, crowd, person
Job: Teacher, student, lawyer, doctor, patient, waiter, secretary, priest, police, army, soldier, artist, author, manager, reporter, actor, job
Society: religion, heaven, hell, death, medicine, money, dollar, bill, marriage, wedding, team, race (ethnicity), sex (the act), sex (gender), murder, prison, technology, energy, war, peace, attack, election, magazine, newspaper, poison, gun, sport, race (sport), exercise, ball, game, price, contract, drug, sign, science, God
Art: band, song, instrument (musical), music, movie, art
Beverages: coffee, tea, wine, beer, juice, water, milk, beverage
Food: egg, cheese, bread, soup, cake, chicken, pork, beef, apple, banana, orange, lemon, corn, rice, oil, seed, knife, spoon, fork, plate, cup, breakfast, lunch, dinner, sugar, salt, bottle, food
Home: table, chair, bed, dream, window, door, bedroom, kitchen, bathroom, pencil, pen, photograph, soap, book, page, key, paint, letter, note, wall, paper, floor, ceiling, roof, pool, lock, telephone, garden, yard, needle, bag, box, gift, card, ring, tool
Electronics: clock, lamp, fan, cell phone, network, computer, program (computer), laptop, screen, camera, television, radio
Body: head, neck, face, beard, hair, eye, mouth, lip, nose, tooth, ear, tear (drop), tongue, back, toe, finger, foot, hand, leg, arm, shoulder, heart, blood, brain, knee, sweat, disease, bone, voice, skin, body
Nature: sea, ocean, river, mountain, rain, snow, tree, sun, moon, world, Earth, forest, sky, plant, wind, soil/earth, flower, valley, root, lake, star, grass, leaf, air, sand, beach, wave, fire, ice, island, hill, heat, nature
Materials: glass, metal, plastic, wood, stone, diamond, clay, dust, gold, copper, silver, material
Math/Measurements: meter, centimeter, kilogram, inch, foot, pound, half, circle, square, temperature, date, weight, edge, corner
Misc Nouns: map, dot, consonant, vowel, light, sound, yes, no, piece, pain, injury, hole, image, pattern, noun, verb, adjective
Directions: top, bottom, side, front, back, outside, inside, up, down, left, right, straight, north, south, east, west, direction
Seasons: Summer, Spring, Winter, Fall, season
Numbers: 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 30, 31, 32, 40, 41, 42, 50, 51, 52, 60, 61, 62, 70, 71, 72, 80, 81, 82, 90, 91, 92, 100, 101, 102, 110, 111, 1000, 1001, 10000, 100000, million, billion, 1st, 2nd, 3rd, 4th, 5th, number
Months: January, February, March, April, May, June, July, August, September, October, November, December
Days of the week: Monday, Tuesday, Wednesday, Thursday, Friday, Saturday, Sunday
Time: year, month, week, day, hour, minute, second , morning, afternoon, evening, night, time
Verbs: work, play, walk, run, drive, fly, swim, go, stop, follow, think, speak/say, eat, drink, kill, die, smile, laugh, cry, buy, pay, sell, shoot(a gun), learn, jump, smell, hear (a sound), listen (music), taste, touch, see (a bird), watch (TV), kiss, burn, melt, dig, explode, sit, stand, love, pass by, cut, fight, lie down, dance, sleep, wake up, sing, count, marry, pray, win, lose, mix/stir, bend, wash, cook, open, close, write, call, turn, build, teach, grow, draw, feed, catch, throw, clean, find, fall, push, pull, carry, break, wear, hang, shake, sign, beat, lift
Adjectives: long, short (long), tall, short (vs tall), wide, narrow, big/large, small/little, slow, fast, hot, cold, warm, cool, new, old (new), young, old (young), good, bad, wet, dry, sick, healthy, loud, quiet, happy, sad, beautiful, ugly, deaf, blind, nice, mean, rich, poor, thick, thin, expensive, cheap, flat, curved, male, female, tight, loose, high, low, soft, hard, deep, shallow, clean, dirty, strong, weak, dead, alive, heavy, light (heavy), dark, light (dark), nuclear, famous
Pronouns: I, you (singular), he, she, it, we, you (plural, as in “y’all”), they.
Chinese giant salamander (娃娃鱼) a.k.a ‘baby fish’ due to the sound they make that sounds like a baby crying.
The Chinese giant salamander is one of the largest salamanders and one of the largest amphibians in the world. It is fully aquatic and is endemic to rocky mountain streams and lakes in the Yangtze river basin of central China.
The Chinese giant salamander is considered to be a "living fossil". Although protected under Chinese laws, its population has faced severe declined over the last 70 years and is currently (2022) listed as threatened. There are evidence indicating that the Chinese giant salamander may be composed of at least five cryptic species, further compounding each individual species' endangerment.
Here is a video of a 200-year-old Chinese giant salamander that was found in a cave.
Honestly “thanks I hate it” is one of the funniest phrases in the English language
i one time told my italian professor “grazie lo detesto” and she lost her shit, so it’s not just english
“¡Gracias! ¡Lo odio!”
“Danke, ich hasse es.”
“Merci, je déteste”
Tak, jeg hader det.
Bedankt, ik haat het.
Спасибо! Я это ненавижу.
go raibh maith agat, is fuath liom é
どうも! それが嫌い。
411 Writing systems of standard forms of languages
.شکریہ! مجھے اس سے نفرت ہے
(shukriah! mujhay isay nafraat hai.)
kiitti! mä vihaan tätä.
תודה! אני שונא.ת את זה. Toda! Ani sone.t et ze
谢谢,我厌恶它!
Takk, jeg hater det.
Hvala, mrzim to.
Dankon! Mi malamas ğin.
tumblr rosetta stone of disdain
Na gode, na tsane shi!
dzięki! nienawidzę tego!
Terima kasih, ku benci itu!
Diolch! Rwyn casau hi
Благодаря! Мразя го!
Kösz. Utálom!
You mentioned in your intro post that you like chemistry. I’m studying chemistry (started this year), and would like to know why do you like it so much to mention it, your favorite subject, and if you have any tips for studying better? Thanks!
Hi! I think chemistry is a fantastic choice, good luck with your studies and hope you have a lot of fun! I’ve spent about six years of my life studying, tutoring, and working in chemistry-related fields, and even after all that time, I still find it fascinating. I don't really know why. I guess I've always loved natural sciences, and chemistry has less math than, say, physics and requires less memorization than biology.
As for the tips, here's where I'm going to hijack your ask and ramble about everything I found useful in my own studies:
Chemistry is one of those subjects that you just can't brute-force your way through with sheer memorization. You have to understand it. If something doesn't make sense, try to figure it out, ask someone, check the textbook, find the relevant information online (although be careful with that last one). One of the things I had to learn to live with over the course of my studies is that I do not have the time to read everything, sometimes all I can do is read the relevant chapters to make sense of things.
Prioritize gaining practical skills. If you have gaps in your theoretical knowledge, you can fill them by picking up a textbook. This can be done on your own. But practical skills can only be acquired in the lab. I wish someone would have told me that: nowadays I see a lot of job listings requiring experience with HPLC and GC (two types of chromatography), and I know I had the opportunity to get acquainted with them, but I didn't take it.
Then there are common sense suggestions, like taking breaks from studying. You'd be surprised how many people wear their sleepless nights or 10-hour study sessions as a badge of honor. Don't do this. Even while you're taking a break, your brain continues to process what you've been learning. Which means it'll be easier to understand the material, when you come back to it after a few hours. Another thing that helps me with memorization specifically is falling asleep. I read through my cards in the evening, and that information is easier to remember in the morning. But any spaced repetition is good.
For the love of God, stay safe! Not to sound dramatic, but lab safety rules are written in blood. And I beg of you, follow them carefully. Nothing too bad has ever happened to me personally, but there were a few times when I was like "Oops, I shouldn't have done that."
I think it's a good idea to choose early on what you want to specialize in. If you're good with math, physical or theoretical chemistry might be for you. If you have attention to detail and work with precision, I'd recommend analytical chemistry. If you've got high spatial intelligence and good intuition, see if organic chemistry is right for you. If you're fascinated by biochemistry, don't feel intimidated by all of the confusing names and acronyms. It actually makes a lot of sense, if you take some time to figure it out. Feel free to try a few things out before deciding. I was specializing in analytical chemistry in Ukraine, but when I moved to Germany, I've decided I'm more interested in organic chemistry.
Next, I will list a few recourses that have really helped me:
"Organic Chemistry" by Paula Yurkanis Bruice was my absolute favorite textbook and I can't recommend it enough. It explains everything very extensively and in simple terms. Plus, it has good practice exercises, which for some reason were hard to find in other textbooks.
MIT OpenCourseWare is probably the only website that still offers free courses, especially when it comes to more advanced topics.
For those who speak German: "Chemie: Das Basiswissen der Chemie" by Charles E. Mortimer is really good at explaining the basics. I would recommend it to first-year students and non-chemistry majors.
This Youtube channel on Inorganic Chemistry might be useful for German speakers.
Other good Youtube channels (this time in English, I swear) include: ChemComplete and Professor Dave Explains.
When I needed to brush up on my math skills, Khan Academy was actually quite good, if a bit tedious.
When it comes to physical chemistry textbooks, I'm partial to Atkins. But in my opinion, it can still be difficult to wrap your head around. I just think it was easier than other options I had available.
"Biochemistry and Molecular Biology: How Life Works" by The Great Courses Plus was very helpful, when I was stuck learning the basics of biochemistry. This one you do have to pay for. And uh... skip all of the cringe-y momement when the professor decides to sing. You won't miss anything. I swear, that streaming service has a lot of good courses and not all of them are like this. 😅
Anyway, I'm sorry this got so long. I just thought someone might find this useful, so hopefully it will be.
God could you imagine how mad geologists must have been to slowly watch the "hey all the continents kinda fit like puzzle pieces :)" guy get proven right
It was a woman that did it!
I love girl talk, especially when it’s complex geological theory
@rifle-yes
All the continents really did used to be one body so you really are never alone and girls said it first 💁♀️
My girl is an icon and we regularly turn this photo of her into a meme when men in our department say/do stupid things.
Crucially, Alfred Wegener, "the guy" OP is talking about made a lot of valuable observations, but wasn't able to explain established phenomena.
Wegener's ideas fell apart as soon as someone asked questions like "so how did these continents drift apart?" because all he had was some interesting observations (for example, Wegener noticed that fossils from identical species could be found an ocean apart, but almost as if they had a natural range across two specific areas that were at some point connected).
Without Marie Tharp, Wegener's ideas would have just been interesting food for thought, not a fully developed robust scientific understanding allowing us to predict volcanic eruptions and earthquakes and allowing us to understand continental drift.
It's wild that Wegener's ideas were dismissed as amateurish and Tharp's discoveries and huge quantities of data analysis dismissed as "girl talk". But they sure changed the face of geology and Marie Tharp specifically has saved lives through her diligent charting of the sea floor and her discovery of that rift and its movement.
Losing my mind over this quora comment
GUYS NEW SHARK JUST DROPPED
Well, technically it's not new : it's a nurse shark. What's new, however, is that it's the first xanthic (imagine albinism but in yellow) nurse shark ever found !! Not only it's not common AT ALL to find fishes with xanthism (it's the first cartilagenous fish ever recorded with this type of genetic "anomally"), but if it's there and still existing as an adult, it means the species is chill-ish with other predators (it probably would have been eaten by then). Its eyes are white so it can also be a form of albinism, in addition to xanthism !!!!!
And most of all : ITS SO CUTE !! AND IT'S SUCH A COOL FIND !!
Please if a marine biologist or someone with more info can interact with this post to feed me some more info or correct me on wrong infos i'e given I'd love it !
(Also if you have pics of animals with xanthism, it's also very appreciated!!)
MANY medications can make you more sensitive to the heat. PSych meds are notorious for it, but its not JUST those. please be careful , especially if you have started a new med (or higher dose) since last summer
Reblog with the first piece(s) of media that made you think of pursuing a stem/scientific career
I'll go first:
Jurassic Park (1993)
And
Hulk (2003)